Incidental Mutation 'R2760:Fam69b'
ID253975
Institutional Source Beutler Lab
Gene Symbol Fam69b
Ensembl Gene ENSMUSG00000036186
Gene Namefamily with sequence similarity 69, member B
SynonymsB230317C12Rik, PIP49
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26628457-26636497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26635825 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 257 (H257R)
Ref Sequence ENSEMBL: ENSMUSP00000073860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074240] [ENSMUST00000174066]
Predicted Effect probably benign
Transcript: ENSMUST00000074240
AA Change: H257R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073860
Gene: ENSMUSG00000036186
AA Change: H257R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PIP49_N 22 180 2.18e-90 SMART
Pfam:PIP49_C 197 399 6.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153849
Predicted Effect probably benign
Transcript: ENSMUST00000174066
SMART Domains Protein: ENSMUSP00000133799
Gene: ENSMUSG00000092356

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181621
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the FAM69 family of cysteine-rich type II transmembrane proteins. These proteins localize to the endoplasmic reticulum but their specific functions are unknown. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Fam69b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Fam69b APN 2 26636115 missense probably benign 0.00
R0669:Fam69b UTSW 2 26634866 missense probably benign 0.00
R1912:Fam69b UTSW 2 26632704 missense probably damaging 1.00
R2258:Fam69b UTSW 2 26635150 missense probably damaging 0.99
R3712:Fam69b UTSW 2 26632638 missense possibly damaging 0.72
R3953:Fam69b UTSW 2 26635567 missense probably benign 0.44
R3956:Fam69b UTSW 2 26635567 missense probably benign 0.44
R4190:Fam69b UTSW 2 26636181 missense probably damaging 1.00
R4213:Fam69b UTSW 2 26635948 missense probably benign 0.05
R5161:Fam69b UTSW 2 26636248 missense possibly damaging 0.92
R5618:Fam69b UTSW 2 26634875 missense probably damaging 0.99
R6198:Fam69b UTSW 2 26635698 missense probably damaging 0.96
R6769:Fam69b UTSW 2 26634863 missense probably benign 0.00
R6771:Fam69b UTSW 2 26634863 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGACTTCAACAAGGATAGCAG -3'
(R):5'- AGCCATCTTGAAGTCGTAGGTAG -3'

Sequencing Primer
(F):5'- CAGAAGCCAAGTCCGTGTG -3'
(R):5'- TAGGTAGCTGTGTACCCCAC -3'
Posted On2014-12-04