Incidental Mutation 'R2517:Ripk3'
ID253980
Institutional Source Beutler Lab
Gene Symbol Ripk3
Ensembl Gene ENSMUSG00000022221
Gene Namereceptor-interacting serine-threonine kinase 3
SynonymsRip3, 2610528K09Rik
MMRRC Submission 040421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2517 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55784995-55788865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55788035 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 24 (V24E)
Ref Sequence ENSEMBL: ENSMUSP00000126306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000022830] [ENSMUST00000168716] [ENSMUST00000170223] [ENSMUST00000178399] [ENSMUST00000227031] [ENSMUST00000228326] [ENSMUST00000228476]
Predicted Effect probably benign
Transcript: ENSMUST00000002398
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000022830
AA Change: V88E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022830
Gene: ENSMUSG00000022221
AA Change: V88E

DomainStartEndE-ValueType
Pfam:Pkinase 22 288 2.8e-38 PFAM
Pfam:Pkinase_Tyr 22 288 3e-34 PFAM
Pfam:RHIM 408 458 2.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168716
AA Change: V24E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126306
Gene: ENSMUSG00000022221
AA Change: V24E

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170223
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178399
AA Change: V24E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137278
Gene: ENSMUSG00000022221
AA Change: V24E

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226361
Predicted Effect probably benign
Transcript: ENSMUST00000227031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228175
Predicted Effect possibly damaging
Transcript: ENSMUST00000228326
AA Change: V24E

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000228476
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out alleles exhibit resistance to induced inflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,594 D65G probably benign Het
Adcy4 C A 14: 55,781,946 E82D probably damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Ago1 G A 4: 126,439,939 R486* probably null Het
Ago2 T A 15: 73,124,242 N346I possibly damaging Het
Apol11a A T 15: 77,517,195 D294V probably benign Het
Atp13a5 A G 16: 29,297,397 F634L possibly damaging Het
Atp2a2 G A 5: 122,457,513 P953L probably damaging Het
Brca2 A G 5: 150,539,672 D967G probably benign Het
Bud13 A T 9: 46,288,148 H269L probably benign Het
Cachd1 A T 4: 100,980,882 probably null Het
Cog3 T C 14: 75,741,742 D188G probably benign Het
Col15a1 T C 4: 47,208,492 S20P probably damaging Het
Col4a3 A G 1: 82,680,710 D838G unknown Het
Cwh43 A T 5: 73,421,543 T298S probably benign Het
Dip2c A G 13: 9,609,005 R847G probably damaging Het
Dnah2 C T 11: 69,516,644 D438N probably damaging Het
Drg2 T C 11: 60,468,128 V358A probably damaging Het
Eif4enif1 T A 11: 3,221,168 W220R probably damaging Het
Enpp2 A T 15: 54,919,694 I75K probably damaging Het
Fam110c T C 12: 31,075,239 I400T probably damaging Het
Fam193b C A 13: 55,542,816 R711L probably damaging Het
Fgfr1 T C 8: 25,563,446 Y246H probably damaging Het
Frs3 G A 17: 47,703,072 R230Q probably benign Het
Galnt5 A G 2: 57,999,413 K342E probably benign Het
Glrb A T 3: 80,861,747 L189Q probably damaging Het
Gmeb2 T C 2: 181,259,026 T193A probably benign Het
Gnl3 A G 14: 31,014,163 S307P probably damaging Het
Golim4 A T 3: 75,892,859 F443I probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Klf10 A C 15: 38,297,113 Y228D probably benign Het
Klrc3 A T 6: 129,639,557 W166R probably damaging Het
Kng2 A T 16: 22,988,315 I378N probably benign Het
Map3k10 T C 7: 27,663,263 K466R possibly damaging Het
Mrrf C T 2: 36,189,097 T245M probably benign Het
Msi1 A G 5: 115,445,458 Y239C probably damaging Het
Nfasc A G 1: 132,597,763 probably null Het
Olfr1375 T A 11: 51,048,473 L122Q probably damaging Het
Olfr843 A T 9: 19,249,061 C113S probably benign Het
Pkd1l1 T C 11: 8,958,900 E368G unknown Het
Polq G A 16: 37,089,325 G2078D probably damaging Het
Ppfibp1 A C 6: 146,992,444 I134L probably damaging Het
Rasip1 A T 7: 45,634,823 I608F probably damaging Het
Rtkn T A 6: 83,147,545 I110N probably damaging Het
Scn1a C T 2: 66,273,832 V1695I probably damaging Het
Shank2 A G 7: 144,052,305 N75S possibly damaging Het
Snu13 C A 15: 82,043,981 A14S probably benign Het
Snx27 A C 3: 94,531,234 D231E probably damaging Het
Spef2 A G 15: 9,725,197 I158T possibly damaging Het
Sptb A G 12: 76,649,869 I19T possibly damaging Het
Ssu72 T C 4: 155,733,513 L175P probably damaging Het
Tecr C T 8: 83,572,575 V248I probably benign Het
Tnfrsf13b T G 11: 61,141,476 S59A probably benign Het
Tom1l1 T C 11: 90,671,125 T150A possibly damaging Het
Ubr3 A T 2: 69,936,018 Y410F probably damaging Het
Vmn2r108 A G 17: 20,472,315 I93T probably damaging Het
Vmn2r19 A G 6: 123,329,978 T482A probably benign Het
Vstm4 T A 14: 32,863,707 M77K probably benign Het
Zbtb17 C T 4: 141,464,585 T309I probably damaging Het
Zfp957 T C 14: 79,214,054 T102A probably damaging Het
Other mutations in Ripk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Ripk3 APN 14 55786027 missense probably damaging 1.00
IGL02073:Ripk3 APN 14 55786025 critical splice donor site probably null
IGL02420:Ripk3 APN 14 55785234 missense probably benign 0.02
IGL03033:Ripk3 APN 14 55787165 unclassified probably benign
IGL03036:Ripk3 APN 14 55787339 missense probably benign 0.01
R0211:Ripk3 UTSW 14 55787918 missense probably damaging 1.00
R0352:Ripk3 UTSW 14 55786743 unclassified probably benign
R0366:Ripk3 UTSW 14 55786835 missense probably damaging 0.99
R0634:Ripk3 UTSW 14 55788391 unclassified probably benign
R1364:Ripk3 UTSW 14 55785260 unclassified probably null
R1665:Ripk3 UTSW 14 55786351 missense probably benign 0.24
R1794:Ripk3 UTSW 14 55785329 missense probably benign 0.45
R1886:Ripk3 UTSW 14 55788237 critical splice donor site probably null
R3409:Ripk3 UTSW 14 55788241 missense probably damaging 0.99
R3806:Ripk3 UTSW 14 55786268 missense probably benign 0.00
R5807:Ripk3 UTSW 14 55785298 missense probably damaging 1.00
R7138:Ripk3 UTSW 14 55788346 missense probably benign
R7278:Ripk3 UTSW 14 55787284 nonsense probably null
Z1088:Ripk3 UTSW 14 55787926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGAATGTTAGAGGGCTTG -3'
(R):5'- GATCGTGAACTCGTGAGTGACC -3'

Sequencing Primer
(F):5'- CAGAATGTTAGAGGGCTTGAGGTCC -3'
(R):5'- CCCAGCTGTAGTCAGAGTGTG -3'
Posted On2014-12-04