Incidental Mutation 'R2760:Haus6'
Institutional Source Beutler Lab
Gene Symbol Haus6
Ensembl Gene ENSMUSG00000038047
Gene NameHAUS augmin-like complex, subunit 6
Synonyms6230416J20Rik, D4Ertd27e
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.587) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosomal Location86578855-86612055 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86583176 bp
Amino Acid Change Tyrosine to Stop codon at position 819 (Y819*)
Ref Sequence ENSEMBL: ENSMUSP00000070504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070607]
Predicted Effect probably null
Transcript: ENSMUST00000070607
AA Change: Y819*
SMART Domains Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047
AA Change: Y819*

Pfam:HAUS6_N 14 238 1.1e-77 PFAM
low complexity region 613 624 N/A INTRINSIC
low complexity region 771 785 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158333
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E2.5 and E7.5 with delayed or incomplete clustering of microtubule-organizing centers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Haus6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Haus6 APN 4 86607981 missense probably benign 0.32
IGL02307:Haus6 APN 4 86583835 missense possibly damaging 0.53
IGL03113:Haus6 APN 4 86583106 nonsense probably null
IGL03384:Haus6 APN 4 86583525 missense probably benign
R0436:Haus6 UTSW 4 86585807 missense probably benign 0.00
R0491:Haus6 UTSW 4 86602846 missense possibly damaging 0.93
R0620:Haus6 UTSW 4 86583514 missense possibly damaging 0.53
R1118:Haus6 UTSW 4 86585326 critical splice donor site probably null
R1969:Haus6 UTSW 4 86604246 missense probably damaging 0.99
R1985:Haus6 UTSW 4 86593609 missense possibly damaging 0.96
R2213:Haus6 UTSW 4 86581992 missense possibly damaging 0.53
R2448:Haus6 UTSW 4 86589001 missense possibly damaging 0.53
R2567:Haus6 UTSW 4 86585885 nonsense probably null
R3714:Haus6 UTSW 4 86602867 missense probably benign 0.01
R3962:Haus6 UTSW 4 86611804 missense possibly damaging 0.85
R4180:Haus6 UTSW 4 86583574 missense probably benign 0.00
R4736:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4738:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4929:Haus6 UTSW 4 86595433 missense probably benign 0.03
R4933:Haus6 UTSW 4 86585287 intron probably benign
R5027:Haus6 UTSW 4 86605696 missense possibly damaging 0.92
R5199:Haus6 UTSW 4 86582985 missense possibly damaging 0.85
R5240:Haus6 UTSW 4 86583178 missense possibly damaging 0.86
R5580:Haus6 UTSW 4 86599266 missense possibly damaging 0.73
R5781:Haus6 UTSW 4 86601263 missense possibly damaging 0.92
R5865:Haus6 UTSW 4 86586357 missense possibly damaging 0.73
R5926:Haus6 UTSW 4 86599316 missense probably benign
R6154:Haus6 UTSW 4 86583756 missense possibly damaging 0.96
R7166:Haus6 UTSW 4 86583687 missense possibly damaging 0.72
R7183:Haus6 UTSW 4 86583752 missense possibly damaging 0.53
R7418:Haus6 UTSW 4 86594773 missense possibly damaging 0.73
R7843:Haus6 UTSW 4 86586341 missense possibly damaging 0.85
Z1088:Haus6 UTSW 4 86602874 missense possibly damaging 0.71
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-12-04