Incidental Mutation 'R2760:Zbtb8b'
ID253985
Institutional Source Beutler Lab
Gene Symbol Zbtb8b
Ensembl Gene ENSMUSG00000048485
Gene Namezinc finger and BTB domain containing 8b
SynonymsMGC:38362
Accession Numbers

Genbank: NM_153541; MGI: 2387181

Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129425765-129440853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129432500 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 291 (L291M)
Ref Sequence ENSEMBL: ENSMUSP00000101661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053042] [ENSMUST00000106046]
Predicted Effect probably benign
Transcript: ENSMUST00000053042
AA Change: L258M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058157
Gene: ENSMUSG00000048485
AA Change: L258M

DomainStartEndE-ValueType
BTB 24 122 1.89e-25 SMART
low complexity region 132 149 N/A INTRINSIC
ZnF_C2H2 331 353 1.12e-3 SMART
ZnF_C2H2 359 382 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106046
AA Change: L291M

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101661
Gene: ENSMUSG00000048485
AA Change: L291M

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
BTB 57 155 1.89e-25 SMART
low complexity region 165 182 N/A INTRINSIC
ZnF_C2H2 364 386 1.12e-3 SMART
ZnF_C2H2 392 415 1.95e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132556
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Other mutations in Zbtb8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Zbtb8b APN 4 129433259 missense probably damaging 0.96
IGL01989:Zbtb8b APN 4 129432388 missense probably damaging 1.00
IGL03332:Zbtb8b APN 4 129428568 missense probably damaging 1.00
N/A:Zbtb8b UTSW 4 129432568 missense probably benign
PIT4131001:Zbtb8b UTSW 4 129427515 makesense probably null
R0391:Zbtb8b UTSW 4 129432670 missense probably damaging 1.00
R2389:Zbtb8b UTSW 4 129433273 missense probably benign 0.25
R2392:Zbtb8b UTSW 4 129433189 missense probably damaging 1.00
R5028:Zbtb8b UTSW 4 129433000 missense probably damaging 1.00
R5572:Zbtb8b UTSW 4 129428541 missense probably damaging 1.00
R6029:Zbtb8b UTSW 4 129428493 missense probably damaging 1.00
R6671:Zbtb8b UTSW 4 129427784 missense probably damaging 0.99
R6714:Zbtb8b UTSW 4 129432983 missense probably damaging 1.00
R7039:Zbtb8b UTSW 4 129427685 missense possibly damaging 0.48
R7392:Zbtb8b UTSW 4 129432890 missense probably benign 0.01
R7454:Zbtb8b UTSW 4 129432769 missense possibly damaging 0.75
R7634:Zbtb8b UTSW 4 129432962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCTTGCGACCCAAACTC -3'
(R):5'- TGTCTCCTCCCCAGTAGATG -3'

Sequencing Primer
(F):5'- TTGCGACCCAAACTCACCTG -3'
(R):5'- GGGAGTCTAGACTGTACAATATCATC -3'
Posted On2014-12-04