Incidental Mutation 'R2760:Nobox'
ID253989
Institutional Source Beutler Lab
Gene Symbol Nobox
Ensembl Gene ENSMUSG00000029736
Gene NameNOBOX oogenesis homeobox
SynonymsOg2x
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location43303674-43309554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43304106 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 478 (L478P)
Ref Sequence ENSEMBL: ENSMUSP00000031749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031749]
Predicted Effect probably damaging
Transcript: ENSMUST00000031749
AA Change: L478P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031749
Gene: ENSMUSG00000029736
AA Change: L478P

DomainStartEndE-ValueType
HOX 136 198 5.04e-23 SMART
low complexity region 364 384 N/A INTRINSIC
low complexity region 389 403 N/A INTRINSIC
low complexity region 408 420 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172554
AA Change: L277P
SMART Domains Protein: ENSMUSP00000133353
Gene: ENSMUSG00000029736
AA Change: L277P

DomainStartEndE-ValueType
Pfam:Homeobox 1 22 4e-7 PFAM
low complexity region 161 173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183706
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This homeobox gene encodes a transcription factor that is thought to play a role in oogenesis. In mice, it is essential for folliculogenesis and regulation of oocyte-specific genes. Defects in this gene result in premature ovarian failure type 5.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display oocyte degeneration after birth, atrophic ovaries, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Nobox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Nobox APN 6 43304001 missense possibly damaging 0.85
IGL01399:Nobox APN 6 43304038 missense probably benign 0.06
IGL01523:Nobox APN 6 43304123 missense probably damaging 0.96
IGL01762:Nobox APN 6 43303993 missense probably damaging 0.96
IGL02007:Nobox APN 6 43307538 missense probably damaging 0.99
IGL02582:Nobox APN 6 43305039 missense possibly damaging 0.53
IGL02733:Nobox APN 6 43307202 missense possibly damaging 0.95
IGL02902:Nobox APN 6 43305683 missense probably benign 0.12
IGL02988:Nobox UTSW 6 43305161 missense possibly damaging 0.79
R0056:Nobox UTSW 6 43304919 missense probably benign 0.23
R0418:Nobox UTSW 6 43307235 missense probably null
R0699:Nobox UTSW 6 43307210 missense probably benign 0.11
R1387:Nobox UTSW 6 43307198 missense probably damaging 1.00
R1619:Nobox UTSW 6 43307467 missense possibly damaging 0.86
R1630:Nobox UTSW 6 43307212 nonsense probably null
R2184:Nobox UTSW 6 43304885 missense possibly damaging 0.72
R3752:Nobox UTSW 6 43307233 missense probably damaging 0.96
R4273:Nobox UTSW 6 43306008 missense probably benign 0.12
R4790:Nobox UTSW 6 43305546 missense probably benign 0.12
R4805:Nobox UTSW 6 43305119 missense probably damaging 0.99
R6109:Nobox UTSW 6 43305169 missense probably damaging 0.98
R6759:Nobox UTSW 6 43307604 missense possibly damaging 0.70
R7761:Nobox UTSW 6 43304191 nonsense probably null
R8084:Nobox UTSW 6 43305167 missense possibly damaging 0.92
R8113:Nobox UTSW 6 43306017 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CATAGCAGGCCAGTCCATAG -3'
(R):5'- TTGATTCCACAGGTACAGGAC -3'

Sequencing Primer
(F):5'- TTCCCAGGCCTCCCATAAGG -3'
(R):5'- AGGACCCTGGAGTGGCC -3'
Posted On2014-12-04