Incidental Mutation 'R2760:Slco1a5'
ID253991
Institutional Source Beutler Lab
Gene Symbol Slco1a5
Ensembl Gene ENSMUSG00000063975
Gene Namesolute carrier organic anion transporter family, member 1a5
SynonymsOatp3, Slc21a7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142234227-142322981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 142250271 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 335 (M335I)
Ref Sequence ENSEMBL: ENSMUSP00000137607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081380] [ENSMUST00000111825] [ENSMUST00000128446] [ENSMUST00000153268]
Predicted Effect probably benign
Transcript: ENSMUST00000081380
AA Change: M335I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000080116
Gene: ENSMUSG00000063975
AA Change: M335I

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 4.3e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111822
Predicted Effect probably benign
Transcript: ENSMUST00000111825
AA Change: M335I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000137607
Gene: ENSMUSG00000063975
AA Change: M335I

DomainStartEndE-ValueType
Pfam:MFS_1 22 420 5.8e-30 PFAM
KAZAL 438 486 2.18e0 SMART
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128446
SMART Domains Protein: ENSMUSP00000124987
Gene: ENSMUSG00000063975

DomainStartEndE-ValueType
Pfam:OATP 1 157 6.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153268
SMART Domains Protein: ENSMUSP00000124829
Gene: ENSMUSG00000063975

DomainStartEndE-ValueType
Pfam:OATP 19 74 3.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased percentage of CD8 ells and increased percentage of B cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Slco1a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Slco1a5 APN 6 142242150 missense probably benign 0.00
IGL01432:Slco1a5 APN 6 142236286 missense possibly damaging 0.59
IGL01590:Slco1a5 APN 6 142250319 missense probably benign 0.01
IGL01824:Slco1a5 APN 6 142253037 missense probably benign 0.01
IGL01915:Slco1a5 APN 6 142243873 missense probably benign 0.00
IGL01945:Slco1a5 APN 6 142243989 critical splice acceptor site probably null
IGL02078:Slco1a5 APN 6 142254446 missense probably benign 0.30
IGL02178:Slco1a5 APN 6 142262688 nonsense probably null
IGL02366:Slco1a5 APN 6 142250215 missense possibly damaging 0.57
IGL02395:Slco1a5 APN 6 142275487 missense probably damaging 0.99
IGL02621:Slco1a5 APN 6 142242015 missense probably benign 0.10
IGL02752:Slco1a5 APN 6 142262712 missense probably benign 0.07
IGL02940:Slco1a5 APN 6 142242005 missense probably damaging 1.00
IGL03065:Slco1a5 APN 6 142248843 splice site probably benign
IGL03377:Slco1a5 APN 6 142234766 missense probably benign 0.01
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0017:Slco1a5 UTSW 6 142236335 splice site probably benign
R0230:Slco1a5 UTSW 6 142236328 splice site probably benign
R0690:Slco1a5 UTSW 6 142268278 missense probably benign 0.24
R1217:Slco1a5 UTSW 6 142254374 missense probably damaging 0.98
R1900:Slco1a5 UTSW 6 142242063 missense probably benign 0.44
R2084:Slco1a5 UTSW 6 142234711 missense probably benign 0.32
R2393:Slco1a5 UTSW 6 142248775 missense possibly damaging 0.85
R2414:Slco1a5 UTSW 6 142236250 missense probably damaging 1.00
R3420:Slco1a5 UTSW 6 142268238 missense possibly damaging 0.61
R3421:Slco1a5 UTSW 6 142268238 missense possibly damaging 0.61
R3827:Slco1a5 UTSW 6 142253249 missense probably damaging 0.97
R3963:Slco1a5 UTSW 6 142248644 critical splice donor site probably null
R3977:Slco1a5 UTSW 6 142258972 splice site probably benign
R4074:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4075:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4076:Slco1a5 UTSW 6 142268224 missense possibly damaging 0.88
R4782:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4799:Slco1a5 UTSW 6 142248807 missense possibly damaging 0.82
R4831:Slco1a5 UTSW 6 142234705 missense probably benign
R5038:Slco1a5 UTSW 6 142262637 missense probably benign 0.01
R5038:Slco1a5 UTSW 6 142266364 missense probably damaging 1.00
R5063:Slco1a5 UTSW 6 142259065 missense probably damaging 1.00
R5273:Slco1a5 UTSW 6 142242098 missense probably benign 0.00
R5436:Slco1a5 UTSW 6 142254392 missense probably damaging 1.00
R5579:Slco1a5 UTSW 6 142242125 missense possibly damaging 0.93
R5602:Slco1a5 UTSW 6 142275529 start gained probably benign
R5643:Slco1a5 UTSW 6 142237594 splice site probably null
R5644:Slco1a5 UTSW 6 142237594 splice site probably null
R5686:Slco1a5 UTSW 6 142236307 missense probably damaging 1.00
R5699:Slco1a5 UTSW 6 142248816 missense probably damaging 0.96
R5792:Slco1a5 UTSW 6 142242113 missense probably damaging 1.00
R5938:Slco1a5 UTSW 6 142248717 missense probably damaging 0.97
R5997:Slco1a5 UTSW 6 142253113 missense probably benign 0.19
R6146:Slco1a5 UTSW 6 142234808 missense probably benign
R6377:Slco1a5 UTSW 6 142242180 splice site probably null
R6466:Slco1a5 UTSW 6 142237534 missense probably benign 0.01
R6523:Slco1a5 UTSW 6 142266395 missense probably damaging 1.00
R7092:Slco1a5 UTSW 6 142248675 missense probably benign
R7207:Slco1a5 UTSW 6 142248749 nonsense probably null
R7356:Slco1a5 UTSW 6 142234732 missense probably benign 0.01
R7430:Slco1a5 UTSW 6 142248712 missense probably benign 0.00
R7445:Slco1a5 UTSW 6 142259008 missense possibly damaging 0.93
R7499:Slco1a5 UTSW 6 142262531 intron probably null
R7579:Slco1a5 UTSW 6 142275481 missense probably benign 0.00
R8117:Slco1a5 UTSW 6 142262692 missense probably damaging 1.00
R8209:Slco1a5 UTSW 6 142262682 missense probably damaging 1.00
R8217:Slco1a5 UTSW 6 142275476 missense probably benign 0.13
R8358:Slco1a5 UTSW 6 142262685 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CTTGTAGTTGTCACTGAGTCTCAC -3'
(R):5'- CTAGAACTTTAGCTCCAAGGGG -3'

Sequencing Primer
(F):5'- GTCACTGAGTCTCACCATCTTACTG -3'
(R):5'- TTAGCTCCAAGGGGTAAAGACCTATC -3'
Posted On2014-12-04