Incidental Mutation 'R2760:Olfr544'
ID253995
Institutional Source Beutler Lab
Gene Symbol Olfr544
Ensembl Gene ENSMUSG00000043925
Gene Nameolfactory receptor 544
SynonymsGA_x6K02T2PBJ9-5206624-5205620, MOR42-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102482031-102488313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102484376 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 248 (H248R)
Ref Sequence ENSEMBL: ENSMUSP00000051280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051201] [ENSMUST00000219647]
Predicted Effect probably damaging
Transcript: ENSMUST00000051201
AA Change: H248R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051280
Gene: ENSMUSG00000043925
AA Change: H248R

DomainStartEndE-ValueType
Pfam:7tm_4 35 314 1.2e-73 PFAM
Pfam:7TM_GPCR_Srsx 39 311 6.3e-8 PFAM
Pfam:7tm_1 45 296 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219647
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Olfr544
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Olfr544 APN 7 102484478 missense probably damaging 1.00
IGL01380:Olfr544 APN 7 102484385 missense probably damaging 1.00
IGL01594:Olfr544 APN 7 102485047 missense probably benign
R0732:Olfr544 UTSW 7 102484443 missense probably benign 0.15
R1061:Olfr544 UTSW 7 102484114 makesense probably null
R1387:Olfr544 UTSW 7 102484704 missense probably benign 0.01
R5151:Olfr544 UTSW 7 102484985 missense probably benign 0.00
R5916:Olfr544 UTSW 7 102484379 missense probably damaging 1.00
R6084:Olfr544 UTSW 7 102484389 missense probably damaging 1.00
R7069:Olfr544 UTSW 7 102484772 missense possibly damaging 0.85
R7195:Olfr544 UTSW 7 102484367 missense probably damaging 1.00
R7738:Olfr544 UTSW 7 102484611 missense probably damaging 0.99
R8299:Olfr544 UTSW 7 102484202 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGAAGACCTGTTGCTGAG -3'
(R):5'- CCTGATGAAGCTTTCCTGTGG -3'

Sequencing Primer
(F):5'- CTGAGTCCTTTGGAACAGAGCTAC -3'
(R):5'- AAGCTTTCCTGTGGGGACATCTC -3'
Posted On2014-12-04