Incidental Mutation 'R2760:Alg11'
ID253997
Institutional Source Beutler Lab
Gene Symbol Alg11
Ensembl Gene ENSMUSG00000063362
Gene Nameasparagine-linked glycosylation 11 (alpha-1,2-mannosyltransferase)
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22060721-22071627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 22068079 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 469 (A469E)
Ref Sequence ENSEMBL: ENSMUSP00000072382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072572] [ENSMUST00000110737]
Predicted Effect probably benign
Transcript: ENSMUST00000072572
AA Change: A469E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072382
Gene: ENSMUSG00000063362
AA Change: A469E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:ALG11_N 62 269 2.6e-94 PFAM
Pfam:Glycos_transf_1 293 470 1.4e-30 PFAM
Pfam:Glyco_trans_1_4 301 454 8.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110737
AA Change: A427E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106365
Gene: ENSMUSG00000063362
AA Change: A427E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
Pfam:Glycos_transf_1 248 428 3.8e-29 PFAM
Pfam:Glyco_trans_1_4 259 412 7.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131624
SMART Domains Protein: ENSMUSP00000119161
Gene: ENSMUSG00000063362

DomainStartEndE-ValueType
Pfam:ALG11_N 4 160 1.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134474
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase which is localized to the cytosolic side of the endoplasmic reticulum (ER) and catalyzes the transfer of the fourth and fifth mannose residue from GDP-mannose (GDP-Man) to Man3GlcNAc2-PP-dolichol and Man4GlcNAc2-PP-dolichol resulting in the production of Man5GlcNAc2-PP-dolichol. Mutations in this gene are associated with congenital disorder of glycosylation type Ip (CDGIP). This gene overlaps but is distinct from the UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) gene. A pseudogene of the GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase has been identified on chromosome 19. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Alg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Alg11 APN 8 22061983 missense probably benign 0.22
1mM(1):Alg11 UTSW 8 22074057 missense probably benign
R0240:Alg11 UTSW 8 22065452 missense possibly damaging 0.83
R1908:Alg11 UTSW 8 22065568 missense probably damaging 1.00
R1980:Alg11 UTSW 8 22061887 missense possibly damaging 0.69
R2090:Alg11 UTSW 8 22065630 missense possibly damaging 0.80
R2147:Alg11 UTSW 8 22065293 missense probably damaging 1.00
R2159:Alg11 UTSW 8 22065845 missense probably benign 0.44
R2265:Alg11 UTSW 8 22065614 missense probably benign
R2761:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2762:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2763:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2764:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2877:Alg11 UTSW 8 22065358 missense possibly damaging 0.93
R4165:Alg11 UTSW 8 22065557 missense probably damaging 1.00
R4230:Alg11 UTSW 8 22065518 missense probably damaging 1.00
R4370:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4371:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4447:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4448:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4450:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4840:Alg11 UTSW 8 22068010 missense possibly damaging 0.91
R5859:Alg11 UTSW 8 22065841 missense probably benign 0.10
R5988:Alg11 UTSW 8 22062028 missense probably benign 0.00
R7293:Alg11 UTSW 8 22065379 missense probably damaging 1.00
R7417:Alg11 UTSW 8 22062028 missense probably benign 0.00
R7610:Alg11 UTSW 8 22065131 missense probably damaging 1.00
R8388:Alg11 UTSW 8 22062034 missense probably benign 0.03
X0019:Alg11 UTSW 8 22065424 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATCCTTGCACACAACTCAGG -3'
(R):5'- AGAATGTTGCTCAGGCTGC -3'

Sequencing Primer
(F):5'- CAACTCAGGAGGCCCGAAG -3'
(R):5'- CTCAGGCTGCTTTGATTATGATAAAG -3'
Posted On2014-12-04