Incidental Mutation 'R2760:Olfr981'
ID253999
Institutional Source Beutler Lab
Gene Symbol Olfr981
Ensembl Gene ENSMUSG00000046678
Gene Nameolfactory receptor 981
SynonymsMOR223-8, GA_x6K02T2PVTD-33720892-33721824
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location40021464-40030377 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 40022396 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000149436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059859] [ENSMUST00000215956]
Predicted Effect probably null
Transcript: ENSMUST00000059859
AA Change: M1K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000057952
Gene: ENSMUSG00000046678
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.4e-54 PFAM
Pfam:7tm_1 41 288 8.8e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215956
AA Change: M1K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220338
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Olfr981
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Olfr981 APN 9 40023278 missense possibly damaging 0.61
IGL02089:Olfr981 APN 9 40022770 missense probably damaging 1.00
R0722:Olfr981 UTSW 9 40022999 missense probably damaging 1.00
R1117:Olfr981 UTSW 9 40022762 missense probably damaging 0.99
R1781:Olfr981 UTSW 9 40023245 missense probably damaging 1.00
R1874:Olfr981 UTSW 9 40022855 missense possibly damaging 0.86
R1893:Olfr981 UTSW 9 40022974 missense possibly damaging 0.64
R1942:Olfr981 UTSW 9 40022735 missense probably damaging 1.00
R1942:Olfr981 UTSW 9 40022752 missense probably damaging 1.00
R1999:Olfr981 UTSW 9 40022689 missense probably benign
R2000:Olfr981 UTSW 9 40022689 missense probably benign
R2173:Olfr981 UTSW 9 40023254 missense probably damaging 0.97
R4300:Olfr981 UTSW 9 40023139 missense probably benign 0.02
R4530:Olfr981 UTSW 9 40023293 missense probably benign
R4614:Olfr981 UTSW 9 40022959 missense probably damaging 1.00
R4661:Olfr981 UTSW 9 40022527 missense probably damaging 1.00
R4777:Olfr981 UTSW 9 40022698 missense possibly damaging 0.90
R5017:Olfr981 UTSW 9 40022376 start gained probably benign
R5065:Olfr981 UTSW 9 40023250 missense probably benign 0.44
R5467:Olfr981 UTSW 9 40022437 missense probably benign 0.00
R5668:Olfr981 UTSW 9 40022668 missense probably damaging 1.00
R5687:Olfr981 UTSW 9 40022435 missense probably damaging 1.00
R6432:Olfr981 UTSW 9 40022528 missense probably damaging 1.00
R6620:Olfr981 UTSW 9 40022929 missense probably damaging 1.00
R6992:Olfr981 UTSW 9 40022600 nonsense probably null
R7156:Olfr981 UTSW 9 40023230 missense probably benign 0.23
R7250:Olfr981 UTSW 9 40022754 nonsense probably null
R7273:Olfr981 UTSW 9 40022665 missense probably benign 0.04
R8006:Olfr981 UTSW 9 40022474 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAATCTCAGTTGGGGCGG -3'
(R):5'- GCCAGATAGCATCTTTGGGAC -3'

Sequencing Primer
(F):5'- TGGTAAGGAACAAGAGAGTGATTC -3'
(R):5'- GGTGACATAGGAACCAGTACATG -3'
Posted On2014-12-04