Incidental Mutation 'R2760:Ube2cbp'
ID254004
Institutional Source Beutler Lab
Gene Symbol Ube2cbp
Ensembl Gene ENSMUSG00000032415
Gene Nameubiquitin-conjugating enzyme E2C binding protein
Synonyms2610018I03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location86307306-86464950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86422974 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 272 (I272V)
Ref Sequence ENSEMBL: ENSMUSP00000034986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034986] [ENSMUST00000121189]
Predicted Effect probably benign
Transcript: ENSMUST00000034986
AA Change: I272V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034986
Gene: ENSMUSG00000032415
AA Change: I272V

DomainStartEndE-ValueType
Pfam:HECT_2 13 364 1e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121189
SMART Domains Protein: ENSMUSP00000113549
Gene: ENSMUSG00000032415

DomainStartEndE-ValueType
Pfam:HECT_2 13 364 2.6e-80 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele cannot be obtained. Heterozygotes exhibit abnormal retinal pigment epithelium morphology and decreased a- and b-wave amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Ube2cbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0653:Ube2cbp UTSW 9 86451990 missense possibly damaging 0.95
R1163:Ube2cbp UTSW 9 86440595 missense probably benign 0.00
R1928:Ube2cbp UTSW 9 86423003 missense probably damaging 1.00
R1938:Ube2cbp UTSW 9 86448787 missense probably damaging 1.00
R2131:Ube2cbp UTSW 9 86372487 splice site probably null
R4916:Ube2cbp UTSW 9 86422872 missense probably damaging 1.00
R5434:Ube2cbp UTSW 9 86427407 missense possibly damaging 0.95
R5804:Ube2cbp UTSW 9 86425348 missense probably benign 0.01
R5827:Ube2cbp UTSW 9 86372436 missense possibly damaging 0.95
R5936:Ube2cbp UTSW 9 86372459 missense probably benign 0.00
R7275:Ube2cbp UTSW 9 86440626 missense probably damaging 1.00
R7507:Ube2cbp UTSW 9 86422886 missense possibly damaging 0.95
R7533:Ube2cbp UTSW 9 86422937 missense probably damaging 0.98
R7787:Ube2cbp UTSW 9 86372342 missense possibly damaging 0.79
X0019:Ube2cbp UTSW 9 86422888 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CGCAGCTGAAATGCAACGTG -3'
(R):5'- TCTGGGAGCTCCAAATATTTCAG -3'

Sequencing Primer
(F):5'- TGCAACGTGGAACAGAAAACC -3'
(R):5'- AGCATTGCCATTTATATAGATGCC -3'
Posted On2014-12-04