Incidental Mutation 'R2517:Frs3'
ID254011
Institutional Source Beutler Lab
Gene Symbol Frs3
Ensembl Gene ENSMUSG00000023266
Gene Namefibroblast growth factor receptor substrate 3
Synonyms4930417B13Rik, SNT2, Frs2beta
MMRRC Submission 040421-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Stock #R2517 (G1)
Quality Score217
Status Not validated
Chromosome17
Chromosomal Location47689030-47704286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47703072 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 230 (R230Q)
Ref Sequence ENSEMBL: ENSMUSP00000108921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113296] [ENSMUST00000156118]
Predicted Effect probably benign
Transcript: ENSMUST00000113296
AA Change: R230Q

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108921
Gene: ENSMUSG00000023266
AA Change: R230Q

DomainStartEndE-ValueType
IRS 17 110 4.31e-33 SMART
PTBI 18 110 1.23e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144979
Predicted Effect probably benign
Transcript: ENSMUST00000156118
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a substrate for the fibroblast growth factor receptor. The encoded protein is found in the peripheral plasma membrane and links fibroblast growth factor receptor stimulation to activators of Ras. The encoded protein down-regulates extracellular regulated kinase 2 through direct binding. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,594 D65G probably benign Het
Adcy4 C A 14: 55,781,946 E82D probably damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Ago1 G A 4: 126,439,939 R486* probably null Het
Ago2 T A 15: 73,124,242 N346I possibly damaging Het
Apol11a A T 15: 77,517,195 D294V probably benign Het
Atp13a5 A G 16: 29,297,397 F634L possibly damaging Het
Atp2a2 G A 5: 122,457,513 P953L probably damaging Het
Brca2 A G 5: 150,539,672 D967G probably benign Het
Bud13 A T 9: 46,288,148 H269L probably benign Het
Cachd1 A T 4: 100,980,882 probably null Het
Cog3 T C 14: 75,741,742 D188G probably benign Het
Col15a1 T C 4: 47,208,492 S20P probably damaging Het
Col4a3 A G 1: 82,680,710 D838G unknown Het
Cwh43 A T 5: 73,421,543 T298S probably benign Het
Dip2c A G 13: 9,609,005 R847G probably damaging Het
Dnah2 C T 11: 69,516,644 D438N probably damaging Het
Drg2 T C 11: 60,468,128 V358A probably damaging Het
Eif4enif1 T A 11: 3,221,168 W220R probably damaging Het
Enpp2 A T 15: 54,919,694 I75K probably damaging Het
Fam110c T C 12: 31,075,239 I400T probably damaging Het
Fam193b C A 13: 55,542,816 R711L probably damaging Het
Fgfr1 T C 8: 25,563,446 Y246H probably damaging Het
Galnt5 A G 2: 57,999,413 K342E probably benign Het
Glrb A T 3: 80,861,747 L189Q probably damaging Het
Gmeb2 T C 2: 181,259,026 T193A probably benign Het
Gnl3 A G 14: 31,014,163 S307P probably damaging Het
Golim4 A T 3: 75,892,859 F443I probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Klf10 A C 15: 38,297,113 Y228D probably benign Het
Klrc3 A T 6: 129,639,557 W166R probably damaging Het
Kng2 A T 16: 22,988,315 I378N probably benign Het
Map3k10 T C 7: 27,663,263 K466R possibly damaging Het
Mrrf C T 2: 36,189,097 T245M probably benign Het
Msi1 A G 5: 115,445,458 Y239C probably damaging Het
Nfasc A G 1: 132,597,763 probably null Het
Olfr1375 T A 11: 51,048,473 L122Q probably damaging Het
Olfr843 A T 9: 19,249,061 C113S probably benign Het
Pkd1l1 T C 11: 8,958,900 E368G unknown Het
Polq G A 16: 37,089,325 G2078D probably damaging Het
Ppfibp1 A C 6: 146,992,444 I134L probably damaging Het
Rasip1 A T 7: 45,634,823 I608F probably damaging Het
Ripk3 A T 14: 55,788,035 V24E probably damaging Het
Rtkn T A 6: 83,147,545 I110N probably damaging Het
Scn1a C T 2: 66,273,832 V1695I probably damaging Het
Shank2 A G 7: 144,052,305 N75S possibly damaging Het
Snu13 C A 15: 82,043,981 A14S probably benign Het
Snx27 A C 3: 94,531,234 D231E probably damaging Het
Spef2 A G 15: 9,725,197 I158T possibly damaging Het
Sptb A G 12: 76,649,869 I19T possibly damaging Het
Ssu72 T C 4: 155,733,513 L175P probably damaging Het
Tecr C T 8: 83,572,575 V248I probably benign Het
Tnfrsf13b T G 11: 61,141,476 S59A probably benign Het
Tom1l1 T C 11: 90,671,125 T150A possibly damaging Het
Ubr3 A T 2: 69,936,018 Y410F probably damaging Het
Vmn2r108 A G 17: 20,472,315 I93T probably damaging Het
Vmn2r19 A G 6: 123,329,978 T482A probably benign Het
Vstm4 T A 14: 32,863,707 M77K probably benign Het
Zbtb17 C T 4: 141,464,585 T309I probably damaging Het
Zfp957 T C 14: 79,214,054 T102A probably damaging Het
Other mutations in Frs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0310:Frs3 UTSW 17 47703822 missense probably benign
R0575:Frs3 UTSW 17 47703723 missense possibly damaging 0.89
R0638:Frs3 UTSW 17 47701656 missense probably benign 0.00
R1519:Frs3 UTSW 17 47702978 missense probably benign
R1668:Frs3 UTSW 17 47703222 missense possibly damaging 0.94
R2151:Frs3 UTSW 17 47703062 missense probably benign
R3548:Frs3 UTSW 17 47703636 missense probably damaging 1.00
R3789:Frs3 UTSW 17 47699696 critical splice donor site probably null
R3890:Frs3 UTSW 17 47703435 missense probably damaging 0.99
R4981:Frs3 UTSW 17 47689262 unclassified probably null
R4996:Frs3 UTSW 17 47701710 missense probably damaging 1.00
R5479:Frs3 UTSW 17 47701710 missense probably damaging 1.00
R5944:Frs3 UTSW 17 47692308 intron probably benign
R5990:Frs3 UTSW 17 47701677 missense possibly damaging 0.81
R6102:Frs3 UTSW 17 47702671 missense probably damaging 1.00
R6151:Frs3 UTSW 17 47689088 start gained probably benign
R7219:Frs3 UTSW 17 47702695 missense probably damaging 1.00
R7359:Frs3 UTSW 17 47699525 missense probably damaging 0.98
R7404:Frs3 UTSW 17 47702726 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCCAGTCCTTGAAACCACTTG -3'
(R):5'- TTCTCATAGTGCAGCAGGGC -3'

Sequencing Primer
(F):5'- AGTCCTTGAAACCACTTGATTCAC -3'
(R):5'- TCAGGGCTCAGTCTCCAG -3'
Posted On2014-12-04