Incidental Mutation 'R2760:Lum'
ID254013
Institutional Source Beutler Lab
Gene Symbol Lum
Ensembl Gene ENSMUSG00000036446
Gene Namelumican
SynonymsLdc, SLRR2D
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location97565128-97572703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97568771 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 176 (V176A)
Ref Sequence ENSEMBL: ENSMUSP00000040877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038160]
Predicted Effect probably benign
Transcript: ENSMUST00000038160
AA Change: V176A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040877
Gene: ENSMUSG00000036446
AA Change: V176A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 36 70 1.02e-10 SMART
LRR 66 88 2.14e1 SMART
LRR 89 114 1.92e2 SMART
LRR 135 157 1.67e2 SMART
LRR 158 181 7.8e1 SMART
LRR_TYP 183 206 2.36e-2 SMART
LRR 207 227 6.41e1 SMART
LRR 228 253 6.59e1 SMART
LRR 254 275 4.45e1 SMART
LRR 303 328 3.18e2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene have abnormally large and aberrantly contoured collagen fibrils forming a disorganized matrix in the tendon, skin, cornea and sclera, with consequent reductions in skin tensile strength and corneal clarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1200 T A 2: 88,767,636 R226S possibly damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Lum
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Lum APN 10 97568685 missense probably damaging 1.00
IGL01394:Lum APN 10 97568972 missense probably damaging 1.00
IGL02160:Lum APN 10 97568581 missense probably damaging 0.96
IGL02659:Lum APN 10 97568747 missense probably benign
PIT4305001:Lum UTSW 10 97568876 missense probably damaging 1.00
R0352:Lum UTSW 10 97568609 missense probably damaging 0.97
R0403:Lum UTSW 10 97572043 missense probably benign 0.05
R1446:Lum UTSW 10 97568390 missense possibly damaging 0.88
R4154:Lum UTSW 10 97568953 missense probably damaging 1.00
R4492:Lum UTSW 10 97568438 missense probably damaging 1.00
R7601:Lum UTSW 10 97568306 missense probably damaging 1.00
R8058:Lum UTSW 10 97568563 missense probably benign 0.00
X0065:Lum UTSW 10 97568980 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTGGCTCATTCTTGACCAC -3'
(R):5'- TATTGCAGCCCAGTGAAGC -3'

Sequencing Primer
(F):5'- CCAAGATCAAAGGAAAGGTTTTCTC -3'
(R):5'- CGCTTGAAGTACTCATCCGGAATG -3'
Posted On2014-12-04