Mutagenetix > Incidental Mutations

Incidental Mutation 'R2518:Col3a1'

254016

Institutional Source

Beutler Lab

Gene Symbol

Col3a1

Ensembl Gene

ENSMUSG00000026043

Gene Name

collagen, type III, alpha 1

Synonyms

Col3a-1

MMRRC Submission

040422-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.805) question?

Stock #

R2518 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45311538-45349706 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 45337512 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000139802 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087883] [ENSMUST00000186021]

Predicted Effect

unknown
Transcript: ENSMUST00000087883
AA Change: S735R

SMART Domains

Protein: ENSMUSP00000085192
Gene: ENSMUSG00000026043
AA Change: S735R

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWC	33	89	2.73e-20	SMART
low complexity region	100	140	N/A	INTRINSIC
low complexity region	163	227	N/A	INTRINSIC
low complexity region	230	248	N/A	INTRINSIC
internal_repeat_2	249	284	3.45e-13	PROSPERO
internal_repeat_1	250	290	1.9e-17	PROSPERO
Pfam:Collagen	293	366	7.3e-9	PFAM
low complexity region	368	419	N/A	INTRINSIC
internal_repeat_4	423	476	2.52e-11	PROSPERO
internal_repeat_1	427	488	1.9e-17	PROSPERO
internal_repeat_3	427	491	7.39e-12	PROSPERO
internal_repeat_2	456	491	3.45e-13	PROSPERO
Pfam:Collagen	533	592	2.6e-11	PFAM
low complexity region	632	680	N/A	INTRINSIC
low complexity region	683	776	N/A	INTRINSIC
low complexity region	784	815	N/A	INTRINSIC
low complexity region	818	855	N/A	INTRINSIC
low complexity region	865	921	N/A	INTRINSIC
low complexity region	925	950	N/A	INTRINSIC
low complexity region	953	974	N/A	INTRINSIC
internal_repeat_4	975	1028	2.52e-11	PROSPERO
internal_repeat_3	976	1029	7.39e-12	PROSPERO
internal_repeat_5	977	991	3.33e-5	PROSPERO
internal_repeat_5	1019	1033	3.33e-5	PROSPERO
low complexity region	1037	1058	N/A	INTRINSIC
Pfam:Collagen	1076	1135	5.6e-13	PFAM
Pfam:Collagen	1136	1209	4.3e-11	PFAM
COLFI	1229	1464	5.73e-166	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185687

Predicted Effect

probably benign
Transcript: ENSMUST00000186021

SMART Domains

Protein: ENSMUSP00000139802
Gene: ENSMUSG00000026043

Domain	Start	End	E-Value	Type
Pfam:Collagen	3	62	1.5e-11	PFAM
COLFI	96	244	7.9e-68	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190943

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type III collagen found in bone, cartilage, dentin, tendon, bone marrow stroma and other connective tissue. The encoded protein forms homotrimeric type III procollagen that undergoes proteolytic processing during fibril formation. A majority of mice lacking the encoded protein die within two days of birth but about 5% of the animals survive to adulthood. The surviving mice exhibit severe cortical malformation and experience significantly shorter lifespan. The mutant mouse named "tight skin 2" exhibiting systemic sclerosis phenotype was found to harbor a missense point mutation in this gene. A pseudogene of this gene has been defined on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Most homozygous mutants die within 48 hours after birth. Surviving mutants have reduced body size, skin lesions, enlarged intestines, and die by 6 months of age from ruptured blood vessels. Occasionally intestinal rupture also results in early death. Heterozygotes exhibit tight skin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110034G24Rik	T	A	2: 132,750,527	S165T	probably damaging	Het
Adam18	A	G	8: 24,637,141	C480R	probably damaging	Het
Aftph	G	T	11: 20,725,797	T604K	probably damaging	Het
Bivm	T	C	1: 44,129,615	V279A	probably damaging	Het
C2cd2	G	A	16: 97,922,086	T77I	probably benign	Het
Ccdc146	T	C	5: 21,305,528	H527R	probably benign	Het
Cd226	A	G	18: 89,207,327	N116S	probably benign	Het
Cit	A	G	5: 115,987,046	K1612E	probably damaging	Het
Cmtr1	T	A	17: 29,681,980	Y663*	probably null	Het
Copa	A	G	1: 172,119,901	N1095D	probably benign	Het
Cpne1	G	T	2: 156,073,971	A433E	probably damaging	Het
Cyfip1	C	T	7: 55,928,284	L1181F	probably damaging	Het
Dnajc6	T	A	4: 101,612,930	I220N	probably damaging	Het
Duxbl1	G	C	14: 25,987,748		probably benign	Het
Fam135b	C	T	15: 71,463,911	R478H	probably benign	Het
Fam91a1	T	A	15: 58,450,600	S734T	possibly damaging	Het
Fut10	T	G	8: 31,236,467	S417A	probably benign	Het
Gm9945	C	T	11: 53,480,336		probably benign	Het
Golga4	A	G	9: 118,556,612	E934G	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Hdac5	A	G	11: 102,197,136	V949A	probably damaging	Het
Hdgfl1	G	T	13: 26,769,749	L114I	probably benign	Het
Ifi27l2b	T	A	12: 103,455,824	M94L	unknown	Het
Irs2	C	A	8: 11,005,352	A1027S	probably benign	Het
Itga2	A	T	13: 114,881,042	C111S	probably damaging	Het
Khdrbs1	T	C	4: 129,720,747	T338A	probably benign	Het
Klk1	T	C	7: 44,220,737		probably null	Het
Kmt2b	T	C	7: 30,576,068	N1822S	probably benign	Het
Lrig3	T	C	10: 125,994,441	I136T	probably benign	Het
Lyar	T	A	5: 38,227,932	D105E	probably benign	Het
Mat1a	T	A	14: 41,122,512	D366E	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Naip1	A	T	13: 100,423,219	D1092E	probably benign	Het
Neb	T	A	2: 52,249,511	K95*	probably null	Het
Nectin4	A	G	1: 171,380,208	D56G	probably benign	Het
Nupl1	A	T	14: 60,232,660	F334Y	probably damaging	Het
Olfr1502	A	G	19: 13,862,309	N172S	probably damaging	Het
Olfr294	A	T	7: 86,616,187	F153I	probably benign	Het
Pde8a	C	A	7: 81,317,422	T437K	probably benign	Het
Ppp1r3a	A	T	6: 14,719,378	N512K	possibly damaging	Het
Pqlc2	A	G	4: 139,302,499	F74L	probably damaging	Het
Pramef8	A	G	4: 143,417,903	Q273R	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,067	D330G	probably damaging	Het
Ren1	G	A	1: 133,360,124	A399T	probably damaging	Het
Rnft2	G	T	5: 118,194,605		probably benign	Het
Sept14	A	T	5: 129,699,035	S27T	probably benign	Het
Shox2	T	C	3: 66,978,359	K128E	possibly damaging	Het
Skint1	T	C	4: 112,025,481	W241R	probably benign	Het
Slc24a4	T	A	12: 102,222,051	H134Q	probably benign	Het
Slc25a36	A	T	9: 97,079,071	L165Q	possibly damaging	Het
Slc35f1	A	G	10: 53,073,534	I240V	probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tarbp2	A	G	15: 102,518,557	E3G	possibly damaging	Het
Tas2r130	A	T	6: 131,630,073	I253K	probably damaging	Het
Timm44	A	C	8: 4,266,588	C319G	probably null	Het
Tjap1	A	T	17: 46,260,095	N165K	probably damaging	Het
Tmem63b	A	G	17: 45,666,154	I429T	probably benign	Het
Trabd2b	A	T	4: 114,599,903	D339V	probably damaging	Het
Tst	T	C	15: 78,405,833	M1V	probably null	Het
Ube4a	A	T	9: 44,948,137	N335K	probably benign	Het
Vps54	C	T	11: 21,306,394	T633M	probably benign	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp953	A	G	13: 67,347,939	Y13H	probably damaging	Het

Other mutations in Col3a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Col3a1	APN	1	45347135	missense	probably damaging	1.00
IGL00928:Col3a1	APN	1	45340858	intron	probably benign
IGL00958:Col3a1	APN	1	45327595	missense	unknown
IGL01353:Col3a1	APN	1	45333638	unclassified	probably benign
IGL01820:Col3a1	APN	1	45321608	missense	unknown
IGL01839:Col3a1	APN	1	45311830	missense	unknown
IGL02517:Col3a1	APN	1	45325803	critical splice acceptor site	probably null
IGL02879:Col3a1	APN	1	45340959	intron	probably benign
IGL02960:Col3a1	APN	1	45328455	missense	unknown
IGL03245:Col3a1	APN	1	45331109	unclassified	probably benign
IGL03308:Col3a1	APN	1	45330617	splice site	probably benign
Kraken	UTSW	1	45327866	splice site	probably null
IGL03050:Col3a1	UTSW	1	45328925	splice site	probably null
PIT4520001:Col3a1	UTSW	1	45335783	critical splice donor site	probably null
R0063:Col3a1	UTSW	1	45330541	splice site	probably benign
R0122:Col3a1	UTSW	1	45340897	intron	probably benign
R0131:Col3a1	UTSW	1	45328868	splice site	probably benign
R0762:Col3a1	UTSW	1	45321526	missense	unknown
R0765:Col3a1	UTSW	1	45336651	unclassified	probably benign
R0853:Col3a1	UTSW	1	45343324	intron	probably benign
R0898:Col3a1	UTSW	1	45333993	unclassified	probably benign
R1170:Col3a1	UTSW	1	45327601	missense	unknown
R1170:Col3a1	UTSW	1	45347724	missense	probably damaging	1.00
R1440:Col3a1	UTSW	1	45343312	splice site	probably null
R1449:Col3a1	UTSW	1	45321611	missense	unknown
R1526:Col3a1	UTSW	1	45321688	missense	unknown
R1572:Col3a1	UTSW	1	45345968	missense	possibly damaging	0.95
R1585:Col3a1	UTSW	1	45327866	splice site	probably null
R1616:Col3a1	UTSW	1	45328488	critical splice donor site	probably null
R1691:Col3a1	UTSW	1	45348616	unclassified	probably benign
R1876:Col3a1	UTSW	1	45342235	splice site	probably null
R1937:Col3a1	UTSW	1	45334293	unclassified	probably benign
R2093:Col3a1	UTSW	1	45332990	missense	probably damaging	1.00
R2110:Col3a1	UTSW	1	45330145	missense	unknown
R2119:Col3a1	UTSW	1	45346121	missense	probably damaging	1.00
R2256:Col3a1	UTSW	1	45321632	missense	unknown
R2327:Col3a1	UTSW	1	45338611	unclassified	probably benign
R2991:Col3a1	UTSW	1	45335779	unclassified	probably benign
R3405:Col3a1	UTSW	1	45338753	unclassified	probably benign
R3784:Col3a1	UTSW	1	45347135	missense	probably damaging	1.00
R3847:Col3a1	UTSW	1	45321990	missense	unknown
R3848:Col3a1	UTSW	1	45321990	missense	unknown
R3849:Col3a1	UTSW	1	45321990	missense	unknown
R4502:Col3a1	UTSW	1	45348677	unclassified	probably benign
R4503:Col3a1	UTSW	1	45348677	unclassified	probably benign
R4764:Col3a1	UTSW	1	45346110	missense	probably damaging	1.00
R4839:Col3a1	UTSW	1	45323803	splice site	probably null
R4934:Col3a1	UTSW	1	45339952	unclassified	probably benign
R5033:Col3a1	UTSW	1	45346110	missense	probably damaging	1.00
R5123:Col3a1	UTSW	1	45333596	unclassified	probably benign
R5190:Col3a1	UTSW	1	45329084	missense	unknown
R5190:Col3a1	UTSW	1	45344807	intron	probably benign
R5375:Col3a1	UTSW	1	45347899	splice site	probably null
R5407:Col3a1	UTSW	1	45346052	missense	probably benign	0.03
R5627:Col3a1	UTSW	1	45331560	unclassified	probably benign
R5642:Col3a1	UTSW	1	45331712	unclassified	probably benign
R6014:Col3a1	UTSW	1	45321579	nonsense	probably null
R6052:Col3a1	UTSW	1	45345013	unclassified	probably benign
R6263:Col3a1	UTSW	1	45321575	missense	unknown
R6453:Col3a1	UTSW	1	45339378	unclassified	probably benign
R6463:Col3a1	UTSW	1	45342205	intron	probably benign
R6488:Col3a1	UTSW	1	45331534	unclassified	probably benign
R6525:Col3a1	UTSW	1	45347179	missense	possibly damaging	0.88
R6637:Col3a1	UTSW	1	45347730	missense	probably damaging	1.00
R6704:Col3a1	UTSW	1	45347732	missense	probably damaging	1.00
R6744:Col3a1	UTSW	1	45338622	unclassified	probably benign
R6745:Col3a1	UTSW	1	45338622	unclassified	probably benign
R6747:Col3a1	UTSW	1	45338622	unclassified	probably benign
R6858:Col3a1	UTSW	1	45345984	missense	probably damaging	1.00
R6903:Col3a1	UTSW	1	45331988	missense	probably damaging	0.96
R7189:Col3a1	UTSW	1	45333657	missense	unknown
R7194:Col3a1	UTSW	1	45331700	missense	unknown
R7199:Col3a1	UTSW	1	45332141	missense	probably null	0.99
R7204:Col3a1	UTSW	1	45322418	missense	unknown
R7304:Col3a1	UTSW	1	45347811	missense	unknown
R7378:Col3a1	UTSW	1	45327647	splice site	probably null
R7398:Col3a1	UTSW	1	45327813	missense	unknown
R7742:Col3a1	UTSW	1	45345001	missense	unknown
R8072:Col3a1	UTSW	1	45321574	missense	unknown
R8177:Col3a1	UTSW	1	45335764	missense	unknown
R8183:Col3a1	UTSW	1	45334810	missense	unknown
R8445:Col3a1	UTSW	1	45341180	nonsense	probably null
R8490:Col3a1	UTSW	1	45345956	missense	probably benign	0.01
R8546:Col3a1	UTSW	1	45340939	intron	probably benign
Z1177:Col3a1	UTSW	1	45311800	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TAACTGTAGTTGCTGATTCCCG -3'
(R):5'- ATCCTCAGGATTTGCTGGGG -3'

Sequencing Primer
(F):5'- CCCGTAAATATTAGAGAATGCACTTC -3'
(R):5'- TTTCCAGTGCTATACCAAAAGTCC -3'

Posted On

2014-12-04