Mutagenetix > Incidental Mutations

Incidental Mutation 'R2518:Nectin4'

254022

Institutional Source

Beutler Lab

Gene Symbol

Nectin4

Ensembl Gene

ENSMUSG00000006411

Gene Name

nectin cell adhesion molecule 4

Synonyms

1200017F15Rik, Prr4, Pvrl4, nectin 4

MMRRC Submission

040422-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R2518 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

171370099-171388598 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 171380208 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 56 (D56G)

Ref Sequence

ENSEMBL: ENSMUSP00000106917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006578] [ENSMUST00000094325] [ENSMUST00000111286]

Predicted Effect

probably benign
Transcript: ENSMUST00000006578
AA Change: D56G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000006578
Gene: ENSMUSG00000006411
AA Change: D56G

Domain	Start	End	E-Value	Type
IG	36	145	9.26e-8	SMART
Pfam:Ig_2	147	241	4e-4	PFAM
Pfam:C2-set_2	150	233	9e-17	PFAM
IGc2	259	321	9.78e-7	SMART
transmembrane domain	348	370	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000094325
AA Change: D56G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000091883
Gene: ENSMUSG00000006411
AA Change: D56G

Domain	Start	End	E-Value	Type
IG	36	145	9.26e-8	SMART
Pfam:Ig_2	147	241	2.1e-4	PFAM
Pfam:C2-set_2	150	233	8.7e-17	PFAM
IGc2	259	321	9.78e-7	SMART
transmembrane domain	348	370	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111286
AA Change: D56G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000106917
Gene: ENSMUSG00000006411
AA Change: D56G

Domain	Start	End	E-Value	Type
IG	100	209	9.26e-8	SMART
Pfam:C2-set_2	214	297	1.2e-16	PFAM
IGc2	323	385	9.78e-7	SMART
transmembrane domain	412	434	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family. The encoded protein contains two immunoglobulin-like (Ig-like) C2-type domains and one Ig-like V-type domain. It is involved in cell adhesion through trans-homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. The soluble form is produced by proteolytic cleavage at the cell surface by the metalloproteinase ADAM17/TACE. The secreted form is found in both breast tumor cell lines and breast tumor patients. Mutations in this gene are the cause of ectodermal dysplasia-syndactyly syndrome type 1, an autosomal recessive disorder. Alternatively spliced transcript variants have been found but the full-length nature of the variant has not been determined.[provided by RefSeq, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110034G24Rik	T	A	2: 132,750,527	S165T	probably damaging	Het
Adam18	A	G	8: 24,637,141	C480R	probably damaging	Het
Aftph	G	T	11: 20,725,797	T604K	probably damaging	Het
Bivm	T	C	1: 44,129,615	V279A	probably damaging	Het
C2cd2	G	A	16: 97,922,086	T77I	probably benign	Het
Ccdc146	T	C	5: 21,305,528	H527R	probably benign	Het
Cd226	A	G	18: 89,207,327	N116S	probably benign	Het
Cit	A	G	5: 115,987,046	K1612E	probably damaging	Het
Cmtr1	T	A	17: 29,681,980	Y663*	probably null	Het
Col3a1	T	A	1: 45,337,512		probably benign	Het
Copa	A	G	1: 172,119,901	N1095D	probably benign	Het
Cpne1	G	T	2: 156,073,971	A433E	probably damaging	Het
Cyfip1	C	T	7: 55,928,284	L1181F	probably damaging	Het
Dnajc6	T	A	4: 101,612,930	I220N	probably damaging	Het
Duxbl1	G	C	14: 25,987,748		probably benign	Het
Fam135b	C	T	15: 71,463,911	R478H	probably benign	Het
Fam91a1	T	A	15: 58,450,600	S734T	possibly damaging	Het
Fut10	T	G	8: 31,236,467	S417A	probably benign	Het
Gm9945	C	T	11: 53,480,336		probably benign	Het
Golga4	A	G	9: 118,556,612	E934G	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Hdac5	A	G	11: 102,197,136	V949A	probably damaging	Het
Hdgfl1	G	T	13: 26,769,749	L114I	probably benign	Het
Ifi27l2b	T	A	12: 103,455,824	M94L	unknown	Het
Irs2	C	A	8: 11,005,352	A1027S	probably benign	Het
Itga2	A	T	13: 114,881,042	C111S	probably damaging	Het
Khdrbs1	T	C	4: 129,720,747	T338A	probably benign	Het
Klk1	T	C	7: 44,220,737		probably null	Het
Kmt2b	T	C	7: 30,576,068	N1822S	probably benign	Het
Lrig3	T	C	10: 125,994,441	I136T	probably benign	Het
Lyar	T	A	5: 38,227,932	D105E	probably benign	Het
Mat1a	T	A	14: 41,122,512	D366E	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Naip1	A	T	13: 100,423,219	D1092E	probably benign	Het
Neb	T	A	2: 52,249,511	K95*	probably null	Het
Nupl1	A	T	14: 60,232,660	F334Y	probably damaging	Het
Olfr1502	A	G	19: 13,862,309	N172S	probably damaging	Het
Olfr294	A	T	7: 86,616,187	F153I	probably benign	Het
Pde8a	C	A	7: 81,317,422	T437K	probably benign	Het
Ppp1r3a	A	T	6: 14,719,378	N512K	possibly damaging	Het
Pqlc2	A	G	4: 139,302,499	F74L	probably damaging	Het
Pramef8	A	G	4: 143,417,903	Q273R	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,067	D330G	probably damaging	Het
Ren1	G	A	1: 133,360,124	A399T	probably damaging	Het
Rnft2	G	T	5: 118,194,605		probably benign	Het
Sept14	A	T	5: 129,699,035	S27T	probably benign	Het
Shox2	T	C	3: 66,978,359	K128E	possibly damaging	Het
Skint1	T	C	4: 112,025,481	W241R	probably benign	Het
Slc24a4	T	A	12: 102,222,051	H134Q	probably benign	Het
Slc25a36	A	T	9: 97,079,071	L165Q	possibly damaging	Het
Slc35f1	A	G	10: 53,073,534	I240V	probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tarbp2	A	G	15: 102,518,557	E3G	possibly damaging	Het
Tas2r130	A	T	6: 131,630,073	I253K	probably damaging	Het
Timm44	A	C	8: 4,266,588	C319G	probably null	Het
Tjap1	A	T	17: 46,260,095	N165K	probably damaging	Het
Tmem63b	A	G	17: 45,666,154	I429T	probably benign	Het
Trabd2b	A	T	4: 114,599,903	D339V	probably damaging	Het
Tst	T	C	15: 78,405,833	M1V	probably null	Het
Ube4a	A	T	9: 44,948,137	N335K	probably benign	Het
Vps54	C	T	11: 21,306,394	T633M	probably benign	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp953	A	G	13: 67,347,939	Y13H	probably damaging	Het

Other mutations in Nectin4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Nectin4	APN	1	171384686	missense	probably damaging	1.00
IGL01558:Nectin4	APN	1	171384689	missense	probably benign	0.00
IGL02608:Nectin4	APN	1	171384773	missense	probably benign	0.05
R2047:Nectin4	UTSW	1	171385152	missense	possibly damaging	0.61
R2203:Nectin4	UTSW	1	171386229	missense	possibly damaging	0.78
R4125:Nectin4	UTSW	1	171385733	missense	probably benign	0.02
R4708:Nectin4	UTSW	1	171385146	missense	probably benign	0.02
R4856:Nectin4	UTSW	1	171384815	missense	possibly damaging	0.46
R4886:Nectin4	UTSW	1	171384815	missense	possibly damaging	0.46
R5222:Nectin4	UTSW	1	171385257	splice site	probably null
R5264:Nectin4	UTSW	1	171383705	missense	probably benign	0.00
R5661:Nectin4	UTSW	1	171385170	missense	probably damaging	1.00
R6466:Nectin4	UTSW	1	171386753	missense	probably damaging	1.00
R6714:Nectin4	UTSW	1	171370650	start gained	probably benign
R7272:Nectin4	UTSW	1	171386644	missense	probably damaging	1.00
R7302:Nectin4	UTSW	1	171386635	nonsense	probably null
R7318:Nectin4	UTSW	1	171380463	missense	probably benign	0.16
R7669:Nectin4	UTSW	1	171380259	missense	probably benign	0.00
R7732:Nectin4	UTSW	1	171386678	missense	probably benign	0.00
R7751:Nectin4	UTSW	1	171383758	critical splice donor site	probably null
R7912:Nectin4	UTSW	1	171380373	missense	possibly damaging	0.86
R7993:Nectin4	UTSW	1	171383754	missense	probably damaging	1.00
R8029:Nectin4	UTSW	1	171386687	missense	probably benign	0.04
R8306:Nectin4	UTSW	1	171383757	missense	probably null	1.00
R8314:Nectin4	UTSW	1	171384727	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- AAATCGCTCCAGAAGTTCCGG -3'
(R):5'- GCTGACTCTGCATTCGTACTCG -3'

Sequencing Primer
(F):5'- AAGTTCCGGCCGCCTTTG -3'
(R):5'- GCCCTCATCAGCTTGCACAG -3'

Posted On

2014-12-04