Mutagenetix > Incidental Mutations

Incidental Mutation 'R2518:Gpat2'

254028

Institutional Source

Beutler Lab

Gene Symbol

Gpat2

Ensembl Gene

ENSMUSG00000046338

Gene Name

glycerol-3-phosphate acyltransferase 2, mitochondrial

Synonyms

Gpat2, A530057A03Rik

MMRRC Submission

040422-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2518 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127425199-127436092 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 127428291 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 75 (V75M)

Ref Sequence

ENSEMBL: ENSMUSP00000049619 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062211]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062211
AA Change: V75M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000049619
Gene: ENSMUSG00000046338
AA Change: V75M

Domain	Start	End	E-Value	Type
PlsC	199	333	1.45e-11	SMART
Blast:PlsC	347	387	7e-13	BLAST
low complexity region	431	468	N/A	INTRINSIC
low complexity region	515	528	N/A	INTRINSIC
low complexity region	593	613	N/A	INTRINSIC
low complexity region	664	675	N/A	INTRINSIC

Meta Mutation Damage Score

0.5699

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110034G24Rik	T	A	2: 132,750,527	S165T	probably damaging	Het
Adam18	A	G	8: 24,637,141	C480R	probably damaging	Het
Aftph	G	T	11: 20,725,797	T604K	probably damaging	Het
Bivm	T	C	1: 44,129,615	V279A	probably damaging	Het
C2cd2	G	A	16: 97,922,086	T77I	probably benign	Het
Ccdc146	T	C	5: 21,305,528	H527R	probably benign	Het
Cd226	A	G	18: 89,207,327	N116S	probably benign	Het
Cit	A	G	5: 115,987,046	K1612E	probably damaging	Het
Cmtr1	T	A	17: 29,681,980	Y663*	probably null	Het
Col3a1	T	A	1: 45,337,512		probably benign	Het
Copa	A	G	1: 172,119,901	N1095D	probably benign	Het
Cpne1	G	T	2: 156,073,971	A433E	probably damaging	Het
Cyfip1	C	T	7: 55,928,284	L1181F	probably damaging	Het
Dnajc6	T	A	4: 101,612,930	I220N	probably damaging	Het
Duxbl1	G	C	14: 25,987,748		probably benign	Het
Fam135b	C	T	15: 71,463,911	R478H	probably benign	Het
Fam91a1	T	A	15: 58,450,600	S734T	possibly damaging	Het
Fut10	T	G	8: 31,236,467	S417A	probably benign	Het
Gm9945	C	T	11: 53,480,336		probably benign	Het
Golga4	A	G	9: 118,556,612	E934G	probably damaging	Het
Hdac5	A	G	11: 102,197,136	V949A	probably damaging	Het
Hdgfl1	G	T	13: 26,769,749	L114I	probably benign	Het
Ifi27l2b	T	A	12: 103,455,824	M94L	unknown	Het
Irs2	C	A	8: 11,005,352	A1027S	probably benign	Het
Itga2	A	T	13: 114,881,042	C111S	probably damaging	Het
Khdrbs1	T	C	4: 129,720,747	T338A	probably benign	Het
Klk1	T	C	7: 44,220,737		probably null	Het
Kmt2b	T	C	7: 30,576,068	N1822S	probably benign	Het
Lrig3	T	C	10: 125,994,441	I136T	probably benign	Het
Lyar	T	A	5: 38,227,932	D105E	probably benign	Het
Mat1a	T	A	14: 41,122,512	D366E	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Naip1	A	T	13: 100,423,219	D1092E	probably benign	Het
Neb	T	A	2: 52,249,511	K95*	probably null	Het
Nectin4	A	G	1: 171,380,208	D56G	probably benign	Het
Nupl1	A	T	14: 60,232,660	F334Y	probably damaging	Het
Olfr1502	A	G	19: 13,862,309	N172S	probably damaging	Het
Olfr294	A	T	7: 86,616,187	F153I	probably benign	Het
Pde8a	C	A	7: 81,317,422	T437K	probably benign	Het
Ppp1r3a	A	T	6: 14,719,378	N512K	possibly damaging	Het
Pqlc2	A	G	4: 139,302,499	F74L	probably damaging	Het
Pramef8	A	G	4: 143,417,903	Q273R	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,067	D330G	probably damaging	Het
Ren1	G	A	1: 133,360,124	A399T	probably damaging	Het
Rnft2	G	T	5: 118,194,605		probably benign	Het
Sept14	A	T	5: 129,699,035	S27T	probably benign	Het
Shox2	T	C	3: 66,978,359	K128E	possibly damaging	Het
Skint1	T	C	4: 112,025,481	W241R	probably benign	Het
Slc24a4	T	A	12: 102,222,051	H134Q	probably benign	Het
Slc25a36	A	T	9: 97,079,071	L165Q	possibly damaging	Het
Slc35f1	A	G	10: 53,073,534	I240V	probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tarbp2	A	G	15: 102,518,557	E3G	possibly damaging	Het
Tas2r130	A	T	6: 131,630,073	I253K	probably damaging	Het
Timm44	A	C	8: 4,266,588	C319G	probably null	Het
Tjap1	A	T	17: 46,260,095	N165K	probably damaging	Het
Tmem63b	A	G	17: 45,666,154	I429T	probably benign	Het
Trabd2b	A	T	4: 114,599,903	D339V	probably damaging	Het
Tst	T	C	15: 78,405,833	M1V	probably null	Het
Ube4a	A	T	9: 44,948,137	N335K	probably benign	Het
Vps54	C	T	11: 21,306,394	T633M	probably benign	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp953	A	G	13: 67,347,939	Y13H	probably damaging	Het

Other mutations in Gpat2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Gpat2	APN	2	127432396	missense	probably benign	0.01
IGL00479:Gpat2	APN	2	127434461	missense	probably damaging	0.99
IGL01393:Gpat2	APN	2	127432651	missense	probably damaging	1.00
IGL01759:Gpat2	APN	2	127430896	missense	possibly damaging	0.94
IGL01764:Gpat2	APN	2	127427536	missense	probably benign	0.18
IGL02631:Gpat2	APN	2	127434232	splice site	probably benign
IGL02657:Gpat2	APN	2	127427331	missense	probably benign	0.04
IGL02813:Gpat2	APN	2	127434455	missense	possibly damaging	0.90
IGL02873:Gpat2	APN	2	127431755	missense	probably benign	0.00
IGL02993:Gpat2	APN	2	127427566	missense	probably damaging	1.00
R6669_gpat2_048	UTSW	2	127431918	missense	possibly damaging	0.90
PIT4494001:Gpat2	UTSW	2	127433880	missense	probably benign	0.00
R0078:Gpat2	UTSW	2	127428249	missense	probably damaging	1.00
R0230:Gpat2	UTSW	2	127435845	missense	possibly damaging	0.95
R1619:Gpat2	UTSW	2	127428717	missense	probably benign	0.00
R1851:Gpat2	UTSW	2	127434819	missense	possibly damaging	0.77
R1939:Gpat2	UTSW	2	127435959	makesense	probably null
R2143:Gpat2	UTSW	2	127433762	missense	probably damaging	1.00
R2165:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3410:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3411:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3898:Gpat2	UTSW	2	127435098	missense	probably damaging	1.00
R4080:Gpat2	UTSW	2	127433622	missense	probably damaging	0.99
R4725:Gpat2	UTSW	2	127431982	missense	possibly damaging	0.83
R4841:Gpat2	UTSW	2	127433967	missense	probably benign	0.10
R5354:Gpat2	UTSW	2	127428723	missense	probably damaging	1.00
R5941:Gpat2	UTSW	2	127428275	missense	possibly damaging	0.53
R6362:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6374:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6375:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6377:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6380:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6381:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6382:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6383:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6384:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6393:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6565:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6594:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6595:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6649:Gpat2	UTSW	2	127432435	missense	possibly damaging	0.81
R6665:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6666:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6667:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6668:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6669:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R7031:Gpat2	UTSW	2	127435475	missense	probably damaging	0.99
R7096:Gpat2	UTSW	2	127428289	missense	probably benign	0.02
R7307:Gpat2	UTSW	2	127434890	missense	probably damaging	1.00
R7313:Gpat2	UTSW	2	127428295	missense	probably damaging	0.99
R7365:Gpat2	UTSW	2	127426981	splice site	probably null
R8111:Gpat2	UTSW	2	127433857	missense	probably damaging	1.00
R8113:Gpat2	UTSW	2	127431347	missense	possibly damaging	0.52
Z1176:Gpat2	UTSW	2	127430882	missense	probably benign
Z1176:Gpat2	UTSW	2	127433808	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCTTAGCTCTAAGAGGGCAA -3'
(R):5'- GAAGGAACTGCAGGGGAGTAAAG -3'

Sequencing Primer
(F):5'- AACTCCACACAAGGGGACAG -3'
(R):5'- GCTTGCCTCCATTTGCTATG -3'

Posted On

2014-12-04