Incidental Mutation 'R2761:1700123K08Rik'
ID254035
Institutional Source Beutler Lab
Gene Symbol 1700123K08Rik
Ensembl Gene ENSMUSG00000029526
Gene NameRIKEN cDNA 1700123K08 gene
Synonyms
Accession Numbers

NCBI RefSeq: NM_029693.2; MGI:1923908

Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R2761 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138561840-138564712 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138564174 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 102 (T102A)
Ref Sequence ENSEMBL: ENSMUSP00000031501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031501
AA Change: T102A

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031501
Gene: ENSMUSG00000029526
AA Change: T102A

DomainStartEndE-ValueType
SCOP:d1bkds_ 48 165 6e-22 SMART
Blast:RasGEFN 66 182 2e-57 BLAST
low complexity region 263 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199968
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,780 V910A probably damaging Het
Acoxl T C 2: 127,877,813 Y165H probably benign Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Cdh1 T A 8: 106,653,849 I208N possibly damaging Het
Col11a2 A G 17: 34,051,026 I477V probably damaging Het
Cpa2 A G 6: 30,554,194 D271G probably damaging Het
Dzank1 T C 2: 144,513,449 M109V probably benign Het
Hdac3 A T 18: 37,945,726 S111T probably benign Het
Kremen1 GGG GGGTGG 11: 5,201,792 probably benign Het
Krt31 T C 11: 100,047,865 T301A probably benign Het
Rad21 T A 15: 51,982,643 K10N probably damaging Het
Snap47 T C 11: 59,438,059 D139G probably benign Het
Tango6 C A 8: 106,699,032 T408N possibly damaging Het
Other mutations in 1700123K08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:1700123K08Rik APN 5 138562489 missense probably benign 0.01
IGL02318:1700123K08Rik APN 5 138563576 missense probably damaging 1.00
IGL02451:1700123K08Rik APN 5 138563547 missense probably damaging 1.00
IGL03263:1700123K08Rik APN 5 138564237 missense probably damaging 0.98
P0016:1700123K08Rik UTSW 5 138562938 nonsense probably null
R0686:1700123K08Rik UTSW 5 138564537 missense possibly damaging 0.70
R2051:1700123K08Rik UTSW 5 138564185 missense probably damaging 1.00
R2055:1700123K08Rik UTSW 5 138562845 missense probably damaging 0.99
R2185:1700123K08Rik UTSW 5 138563567 missense probably damaging 1.00
R4233:1700123K08Rik UTSW 5 138564192 missense probably damaging 1.00
R5610:1700123K08Rik UTSW 5 138564141 critical splice donor site probably null
R7136:1700123K08Rik UTSW 5 138562348 missense probably damaging 0.98
R7365:1700123K08Rik UTSW 5 138562936 missense probably benign 0.34
R8130:1700123K08Rik UTSW 5 138563009 missense probably damaging 0.98
R8347:1700123K08Rik UTSW 5 138562891 missense probably benign 0.00
R8350:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8351:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8352:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8450:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8451:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8452:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8475:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
Z1176:1700123K08Rik UTSW 5 138563553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGATGTTTGACACTCCATG -3'
(R):5'- TCTGTTGTGAAAATGATCAGGAGC -3'

Sequencing Primer
(F):5'- ATGTTTGACACTCCATGGGGAC -3'
(R):5'- TGATCAGGAGCCAGACTCTATGC -3'
Posted On2014-12-04