Incidental Mutation 'R2518:Skint1'
ID254039
Institutional Source Beutler Lab
Gene Symbol Skint1
Ensembl Gene ENSMUSG00000089773
Gene Nameselection and upkeep of intraepithelial T cells 1
Synonyms
MMRRC Submission 040422-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2518 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location112006269-112029538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112025481 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 241 (W241R)
Ref Sequence ENSEMBL: ENSMUSP00000124737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117379] [ENSMUST00000161389] [ENSMUST00000162158]
Predicted Effect probably benign
Transcript: ENSMUST00000117379
SMART Domains Protein: ENSMUSP00000124545
Gene: ENSMUSG00000089773

DomainStartEndE-ValueType
IGv 44 125 1.88e-8 SMART
Pfam:C2-set_2 142 228 2.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161389
AA Change: W241R

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125313
Gene: ENSMUSG00000089773
AA Change: W241R

DomainStartEndE-ValueType
IGv 44 125 1.88e-8 SMART
Pfam:C2-set_2 142 228 3.1e-6 PFAM
transmembrane domain 248 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162158
AA Change: W241R

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124737
Gene: ENSMUSG00000089773
AA Change: W241R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGv 44 125 1.88e-8 SMART
transmembrane domain 247 269 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a point mutation allele exhibit impaired T cell differentiation with reduced Vgamma5+Vdelta1+ T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T A 2: 132,750,527 S165T probably damaging Het
Adam18 A G 8: 24,637,141 C480R probably damaging Het
Aftph G T 11: 20,725,797 T604K probably damaging Het
Bivm T C 1: 44,129,615 V279A probably damaging Het
C2cd2 G A 16: 97,922,086 T77I probably benign Het
Ccdc146 T C 5: 21,305,528 H527R probably benign Het
Cd226 A G 18: 89,207,327 N116S probably benign Het
Cit A G 5: 115,987,046 K1612E probably damaging Het
Cmtr1 T A 17: 29,681,980 Y663* probably null Het
Col3a1 T A 1: 45,337,512 probably benign Het
Copa A G 1: 172,119,901 N1095D probably benign Het
Cpne1 G T 2: 156,073,971 A433E probably damaging Het
Cyfip1 C T 7: 55,928,284 L1181F probably damaging Het
Dnajc6 T A 4: 101,612,930 I220N probably damaging Het
Duxbl1 G C 14: 25,987,748 probably benign Het
Fam135b C T 15: 71,463,911 R478H probably benign Het
Fam91a1 T A 15: 58,450,600 S734T possibly damaging Het
Fut10 T G 8: 31,236,467 S417A probably benign Het
Gm9945 C T 11: 53,480,336 probably benign Het
Golga4 A G 9: 118,556,612 E934G probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Hdac5 A G 11: 102,197,136 V949A probably damaging Het
Hdgfl1 G T 13: 26,769,749 L114I probably benign Het
Ifi27l2b T A 12: 103,455,824 M94L unknown Het
Irs2 C A 8: 11,005,352 A1027S probably benign Het
Itga2 A T 13: 114,881,042 C111S probably damaging Het
Khdrbs1 T C 4: 129,720,747 T338A probably benign Het
Klk1 T C 7: 44,220,737 probably null Het
Kmt2b T C 7: 30,576,068 N1822S probably benign Het
Lrig3 T C 10: 125,994,441 I136T probably benign Het
Lyar T A 5: 38,227,932 D105E probably benign Het
Mat1a T A 14: 41,122,512 D366E probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T A 2: 52,249,511 K95* probably null Het
Nectin4 A G 1: 171,380,208 D56G probably benign Het
Nupl1 A T 14: 60,232,660 F334Y probably damaging Het
Olfr1502 A G 19: 13,862,309 N172S probably damaging Het
Olfr294 A T 7: 86,616,187 F153I probably benign Het
Pde8a C A 7: 81,317,422 T437K probably benign Het
Ppp1r3a A T 6: 14,719,378 N512K possibly damaging Het
Pqlc2 A G 4: 139,302,499 F74L probably damaging Het
Pramef8 A G 4: 143,417,903 Q273R possibly damaging Het
Rad51ap2 A G 12: 11,457,067 D330G probably damaging Het
Ren1 G A 1: 133,360,124 A399T probably damaging Het
Rnft2 G T 5: 118,194,605 probably benign Het
Sept14 A T 5: 129,699,035 S27T probably benign Het
Shox2 T C 3: 66,978,359 K128E possibly damaging Het
Slc24a4 T A 12: 102,222,051 H134Q probably benign Het
Slc25a36 A T 9: 97,079,071 L165Q possibly damaging Het
Slc35f1 A G 10: 53,073,534 I240V probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tarbp2 A G 15: 102,518,557 E3G possibly damaging Het
Tas2r130 A T 6: 131,630,073 I253K probably damaging Het
Timm44 A C 8: 4,266,588 C319G probably null Het
Tjap1 A T 17: 46,260,095 N165K probably damaging Het
Tmem63b A G 17: 45,666,154 I429T probably benign Het
Trabd2b A T 4: 114,599,903 D339V probably damaging Het
Tst T C 15: 78,405,833 M1V probably null Het
Ube4a A T 9: 44,948,137 N335K probably benign Het
Vps54 C T 11: 21,306,394 T633M probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp953 A G 13: 67,347,939 Y13H probably damaging Het
Other mutations in Skint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Skint1 APN 4 112021580 critical splice donor site probably null
IGL01890:Skint1 APN 4 112010681 missense probably damaging 1.00
IGL02020:Skint1 APN 4 112025527 missense probably benign 0.08
IGL02045:Skint1 APN 4 112025530 missense possibly damaging 0.80
R0421:Skint1 UTSW 4 112019014 missense possibly damaging 0.74
R0544:Skint1 UTSW 4 112021365 missense probably damaging 1.00
R0617:Skint1 UTSW 4 112029399 splice site probably benign
R0881:Skint1 UTSW 4 112028857 missense probably benign 0.04
R0973:Skint1 UTSW 4 112028215 splice site probably benign
R1036:Skint1 UTSW 4 112019296 missense possibly damaging 0.71
R1469:Skint1 UTSW 4 112025511 missense probably benign 0.00
R1469:Skint1 UTSW 4 112025511 missense probably benign 0.00
R2029:Skint1 UTSW 4 112021456 splice site probably null
R2063:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2064:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2065:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2066:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2067:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2372:Skint1 UTSW 4 112019151 missense probably damaging 1.00
R2971:Skint1 UTSW 4 112021330 missense possibly damaging 0.50
R4656:Skint1 UTSW 4 112021477 missense probably damaging 1.00
R4993:Skint1 UTSW 4 112028333 critical splice donor site probably null
R5083:Skint1 UTSW 4 112029433 missense probably benign 0.01
R5450:Skint1 UTSW 4 112025532 missense probably benign 0.00
R5583:Skint1 UTSW 4 112019056 missense probably damaging 1.00
R5645:Skint1 UTSW 4 112025502 missense probably benign 0.41
R5877:Skint1 UTSW 4 112021523 nonsense probably null
R5950:Skint1 UTSW 4 112019335 missense probably benign
R5974:Skint1 UTSW 4 112019319 missense probably benign 0.02
R6216:Skint1 UTSW 4 112021482 missense probably benign 0.00
R6494:Skint1 UTSW 4 112010712 missense probably benign 0.06
R7348:Skint1 UTSW 4 112021573 missense probably damaging 1.00
R7752:Skint1 UTSW 4 112019202 missense probably damaging 1.00
R7901:Skint1 UTSW 4 112019202 missense probably damaging 1.00
R8515:Skint1 UTSW 4 112010724 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CACACTTATTCATGCCTGGC -3'
(R):5'- TAGAGCACTTTAAAACAGAGAGACC -3'

Sequencing Primer
(F):5'- GGCTTAGCTTTACTTCAGACAATGC -3'
(R):5'- CCACAAATCAAGGTTTGTGCAG -3'
Posted On2014-12-04