Incidental Mutation 'R2518:Ccdc146'
ID254049
Institutional Source Beutler Lab
Gene Symbol Ccdc146
Ensembl Gene ENSMUSG00000064280
Gene Namecoiled-coil domain containing 146
Synonyms4930528G09Rik
MMRRC Submission 040422-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2518 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21292961-21424677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21305528 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 527 (H527R)
Ref Sequence ENSEMBL: ENSMUSP00000110900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115245] [ENSMUST00000198930]
Predicted Effect probably benign
Transcript: ENSMUST00000115245
AA Change: H527R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280
AA Change: H527R

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
coiled coil region 438 477 N/A INTRINSIC
coiled coil region 549 595 N/A INTRINSIC
coiled coil region 617 663 N/A INTRINSIC
coiled coil region 690 720 N/A INTRINSIC
coiled coil region 770 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199553
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype Homozygous null mice for one allele have unaltered type 1 immunity responses. Homozygous null mice for another allele show partial embryonic lethality, hemorrhage at implantation sites, decreased susceptibility to hepatitis virus infection and prolonged survival of heart grafts.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T A 2: 132,750,527 S165T probably damaging Het
Adam18 A G 8: 24,637,141 C480R probably damaging Het
Aftph G T 11: 20,725,797 T604K probably damaging Het
Bivm T C 1: 44,129,615 V279A probably damaging Het
C2cd2 G A 16: 97,922,086 T77I probably benign Het
Cd226 A G 18: 89,207,327 N116S probably benign Het
Cit A G 5: 115,987,046 K1612E probably damaging Het
Cmtr1 T A 17: 29,681,980 Y663* probably null Het
Col3a1 T A 1: 45,337,512 probably benign Het
Copa A G 1: 172,119,901 N1095D probably benign Het
Cpne1 G T 2: 156,073,971 A433E probably damaging Het
Cyfip1 C T 7: 55,928,284 L1181F probably damaging Het
Dnajc6 T A 4: 101,612,930 I220N probably damaging Het
Duxbl1 G C 14: 25,987,748 probably benign Het
Fam135b C T 15: 71,463,911 R478H probably benign Het
Fam91a1 T A 15: 58,450,600 S734T possibly damaging Het
Fut10 T G 8: 31,236,467 S417A probably benign Het
Gm9945 C T 11: 53,480,336 probably benign Het
Golga4 A G 9: 118,556,612 E934G probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Hdac5 A G 11: 102,197,136 V949A probably damaging Het
Hdgfl1 G T 13: 26,769,749 L114I probably benign Het
Ifi27l2b T A 12: 103,455,824 M94L unknown Het
Irs2 C A 8: 11,005,352 A1027S probably benign Het
Itga2 A T 13: 114,881,042 C111S probably damaging Het
Khdrbs1 T C 4: 129,720,747 T338A probably benign Het
Klk1 T C 7: 44,220,737 probably null Het
Kmt2b T C 7: 30,576,068 N1822S probably benign Het
Lrig3 T C 10: 125,994,441 I136T probably benign Het
Lyar T A 5: 38,227,932 D105E probably benign Het
Mat1a T A 14: 41,122,512 D366E probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T A 2: 52,249,511 K95* probably null Het
Nectin4 A G 1: 171,380,208 D56G probably benign Het
Nupl1 A T 14: 60,232,660 F334Y probably damaging Het
Olfr1502 A G 19: 13,862,309 N172S probably damaging Het
Olfr294 A T 7: 86,616,187 F153I probably benign Het
Pde8a C A 7: 81,317,422 T437K probably benign Het
Ppp1r3a A T 6: 14,719,378 N512K possibly damaging Het
Pqlc2 A G 4: 139,302,499 F74L probably damaging Het
Pramef8 A G 4: 143,417,903 Q273R possibly damaging Het
Rad51ap2 A G 12: 11,457,067 D330G probably damaging Het
Ren1 G A 1: 133,360,124 A399T probably damaging Het
Rnft2 G T 5: 118,194,605 probably benign Het
Sept14 A T 5: 129,699,035 S27T probably benign Het
Shox2 T C 3: 66,978,359 K128E possibly damaging Het
Skint1 T C 4: 112,025,481 W241R probably benign Het
Slc24a4 T A 12: 102,222,051 H134Q probably benign Het
Slc25a36 A T 9: 97,079,071 L165Q possibly damaging Het
Slc35f1 A G 10: 53,073,534 I240V probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tarbp2 A G 15: 102,518,557 E3G possibly damaging Het
Tas2r130 A T 6: 131,630,073 I253K probably damaging Het
Timm44 A C 8: 4,266,588 C319G probably null Het
Tjap1 A T 17: 46,260,095 N165K probably damaging Het
Tmem63b A G 17: 45,666,154 I429T probably benign Het
Trabd2b A T 4: 114,599,903 D339V probably damaging Het
Tst T C 15: 78,405,833 M1V probably null Het
Ube4a A T 9: 44,948,137 N335K probably benign Het
Vps54 C T 11: 21,306,394 T633M probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp953 A G 13: 67,347,939 Y13H probably damaging Het
Other mutations in Ccdc146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ccdc146 APN 5 21301422 missense possibly damaging 0.93
IGL01066:Ccdc146 APN 5 21319542 missense probably benign 0.03
IGL01399:Ccdc146 APN 5 21294613 missense possibly damaging 0.75
IGL01866:Ccdc146 APN 5 21333054 missense probably damaging 0.99
IGL01868:Ccdc146 APN 5 21333054 missense probably damaging 0.99
IGL01869:Ccdc146 APN 5 21316839 missense probably benign 0.25
IGL02213:Ccdc146 APN 5 21316904 missense probably benign 0.10
IGL02338:Ccdc146 APN 5 21319606 unclassified probably benign
IGL02553:Ccdc146 APN 5 21297633 missense probably benign 0.00
IGL02838:Ccdc146 APN 5 21297569 missense probably benign 0.01
Starcraft UTSW 5 21399614 splice site probably null
R0051:Ccdc146 UTSW 5 21316904 missense possibly damaging 0.58
R0051:Ccdc146 UTSW 5 21316904 missense possibly damaging 0.58
R0055:Ccdc146 UTSW 5 21297006 synonymous probably null
R0115:Ccdc146 UTSW 5 21322756 missense possibly damaging 0.87
R0373:Ccdc146 UTSW 5 21319545 missense probably benign 0.00
R1251:Ccdc146 UTSW 5 21293372 missense probably benign 0.00
R1355:Ccdc146 UTSW 5 21321242 missense probably damaging 1.00
R1405:Ccdc146 UTSW 5 21399732 missense probably benign 0.00
R1405:Ccdc146 UTSW 5 21399732 missense probably benign 0.00
R1470:Ccdc146 UTSW 5 21319566 missense probably damaging 1.00
R1470:Ccdc146 UTSW 5 21319566 missense probably damaging 1.00
R1556:Ccdc146 UTSW 5 21330553 missense probably damaging 1.00
R1613:Ccdc146 UTSW 5 21294524 missense probably damaging 0.99
R1872:Ccdc146 UTSW 5 21301290 missense probably benign 0.01
R2271:Ccdc146 UTSW 5 21399721 missense probably benign 0.15
R2329:Ccdc146 UTSW 5 21308612 critical splice donor site probably null
R2680:Ccdc146 UTSW 5 21305269 missense possibly damaging 0.58
R3116:Ccdc146 UTSW 5 21316955 missense probably benign 0.02
R3121:Ccdc146 UTSW 5 21294593 missense possibly damaging 0.56
R3122:Ccdc146 UTSW 5 21294593 missense possibly damaging 0.56
R3159:Ccdc146 UTSW 5 21399792 missense unknown
R3436:Ccdc146 UTSW 5 21297005 missense possibly damaging 0.92
R4043:Ccdc146 UTSW 5 21316943 missense probably benign 0.14
R4226:Ccdc146 UTSW 5 21322758 missense probably benign 0.09
R4493:Ccdc146 UTSW 5 21303193 missense possibly damaging 0.92
R5013:Ccdc146 UTSW 5 21333038 missense probably damaging 1.00
R5024:Ccdc146 UTSW 5 21399614 splice site probably null
R5051:Ccdc146 UTSW 5 21303083 missense possibly damaging 0.77
R5384:Ccdc146 UTSW 5 21308713 missense probably benign 0.37
R5532:Ccdc146 UTSW 5 21305331 missense probably benign 0.02
R5906:Ccdc146 UTSW 5 21301352 missense possibly damaging 0.88
R5927:Ccdc146 UTSW 5 21308621 nonsense probably null
R5951:Ccdc146 UTSW 5 21319579 missense possibly damaging 0.84
R5978:Ccdc146 UTSW 5 21316968 missense probably benign 0.02
R5990:Ccdc146 UTSW 5 21318182 missense probably benign 0.41
R6123:Ccdc146 UTSW 5 21305597 missense possibly damaging 0.93
R6217:Ccdc146 UTSW 5 21317902 intron probably null
R6276:Ccdc146 UTSW 5 21301340 missense probably damaging 0.98
R6665:Ccdc146 UTSW 5 21303094 missense probably damaging 1.00
R7077:Ccdc146 UTSW 5 21305274 missense possibly damaging 0.94
R7204:Ccdc146 UTSW 5 21308626 missense probably benign 0.22
R7336:Ccdc146 UTSW 5 21303112 missense probably benign 0.41
R7608:Ccdc146 UTSW 5 21301452 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCGCTGTTCCTTAAGATTTCC -3'
(R):5'- GGCTCAGTCTCATCTCGTGG -3'

Sequencing Primer
(F):5'- CCAGCTCATTTAATGACATTTTGAG -3'
(R):5'- GTTTCCCAAATGCTGGCATTACAG -3'
Posted On2014-12-04