Incidental Mutation 'R2761:Snap47'
ID 254058
Institutional Source Beutler Lab
Gene Symbol Snap47
Ensembl Gene ENSMUSG00000009894
Gene Name synaptosomal-associated protein, 47
Synonyms SNAP-47, 1110031B06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2761 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 59407134-59451186 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59438059 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 139 (D139G)
Ref Sequence ENSEMBL: ENSMUSP00000116170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010038] [ENSMUST00000120940] [ENSMUST00000125846] [ENSMUST00000132969] [ENSMUST00000136436] [ENSMUST00000145550] [ENSMUST00000150297] [ENSMUST00000156146]
AlphaFold Q8R570
Predicted Effect probably benign
Transcript: ENSMUST00000010038
AA Change: D139G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000010038
Gene: ENSMUSG00000009894
AA Change: D139G

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
low complexity region 335 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120940
AA Change: D139G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113555
Gene: ENSMUSG00000009894
AA Change: D139G

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125846
Predicted Effect probably benign
Transcript: ENSMUST00000132969
AA Change: D139G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000116170
Gene: ENSMUSG00000009894
AA Change: D139G

DomainStartEndE-ValueType
coiled coil region 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136436
AA Change: D139G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000115762
Gene: ENSMUSG00000009894
AA Change: D139G

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145550
Predicted Effect probably benign
Transcript: ENSMUST00000150297
Predicted Effect probably benign
Transcript: ENSMUST00000156146
AA Change: D139G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121880
Gene: ENSMUSG00000009894
AA Change: D139G

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,780 V910A probably damaging Het
1700123K08Rik T C 5: 138,564,174 T102A possibly damaging Het
Acoxl T C 2: 127,877,813 Y165H probably benign Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Cdh1 T A 8: 106,653,849 I208N possibly damaging Het
Col11a2 A G 17: 34,051,026 I477V probably damaging Het
Cpa2 A G 6: 30,554,194 D271G probably damaging Het
Dzank1 T C 2: 144,513,449 M109V probably benign Het
Hdac3 A T 18: 37,945,726 S111T probably benign Het
Kremen1 GGG GGGTGG 11: 5,201,792 probably benign Het
Krt31 T C 11: 100,047,865 T301A probably benign Het
Rad21 T A 15: 51,982,643 K10N probably damaging Het
Tango6 C A 8: 106,699,032 T408N possibly damaging Het
Other mutations in Snap47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Snap47 APN 11 59421651 critical splice acceptor site probably null
IGL02113:Snap47 APN 11 59428436 missense probably damaging 0.99
IGL03290:Snap47 APN 11 59428598 missense probably damaging 1.00
R0126:Snap47 UTSW 11 59437987 missense probably damaging 0.99
R0582:Snap47 UTSW 11 59428433 nonsense probably null
R0633:Snap47 UTSW 11 59428613 missense probably benign 0.25
R0883:Snap47 UTSW 11 59438500 utr 5 prime probably benign
R1657:Snap47 UTSW 11 59428770 missense probably benign 0.08
R1855:Snap47 UTSW 11 59428333 unclassified probably benign
R4079:Snap47 UTSW 11 59428551 missense probably benign 0.38
R4805:Snap47 UTSW 11 59428517 missense possibly damaging 0.91
R4960:Snap47 UTSW 11 59428543 missense probably damaging 1.00
R5212:Snap47 UTSW 11 59428352 missense probably damaging 0.99
R5793:Snap47 UTSW 11 59438192 missense probably damaging 1.00
R7243:Snap47 UTSW 11 59428722 missense probably benign 0.04
R7603:Snap47 UTSW 11 59428547 missense probably damaging 1.00
R7870:Snap47 UTSW 11 59438078 missense probably benign 0.11
R8001:Snap47 UTSW 11 59438354 missense probably benign 0.20
R9156:Snap47 UTSW 11 59428464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATGTCTCTCTGGGATGAGTC -3'
(R):5'- CAAGCACTGGTTCAGCTCAC -3'

Sequencing Primer
(F):5'- TGAGTCCCACATAGTCCACCTAGTAG -3'
(R):5'- CACTGCAGCCTAGTCGAAATGTG -3'
Posted On 2014-12-04