Mutagenetix > Incidental Mutations

Incidental Mutation 'R2518:Pde8a'

254067

Institutional Source

Beutler Lab

Gene Symbol

Pde8a

Ensembl Gene

ENSMUSG00000025584

Gene Name

phosphodiesterase 8A

Synonyms

Pde8

MMRRC Submission

040422-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2518 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81213596-81334533 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 81317422 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 437 (T437K)

Ref Sequence

ENSEMBL: ENSMUSP00000026672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026672]

Predicted Effect

probably benign
Transcript: ENSMUST00000026672
AA Change: T437K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000026672
Gene: ENSMUSG00000025584
AA Change: T437K

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
Blast:REC	79	194	2e-48	BLAST
PAS	211	277	2.18e-2	SMART
Blast:HDc	403	451	4e-11	BLAST
HDc	548	734	5.78e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128154

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130494

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE8 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Targeted disruption of this gene results in a 4-fold increase in basal release of testosterone in isolated Leydig cells as well as a significant increase in the sensitivity to luteinizing hormone, measured as testosterone released into the media. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110034G24Rik	T	A	2: 132,750,527	S165T	probably damaging	Het
Adam18	A	G	8: 24,637,141	C480R	probably damaging	Het
Aftph	G	T	11: 20,725,797	T604K	probably damaging	Het
Bivm	T	C	1: 44,129,615	V279A	probably damaging	Het
C2cd2	G	A	16: 97,922,086	T77I	probably benign	Het
Ccdc146	T	C	5: 21,305,528	H527R	probably benign	Het
Cd226	A	G	18: 89,207,327	N116S	probably benign	Het
Cit	A	G	5: 115,987,046	K1612E	probably damaging	Het
Cmtr1	T	A	17: 29,681,980	Y663*	probably null	Het
Col3a1	T	A	1: 45,337,512		probably benign	Het
Copa	A	G	1: 172,119,901	N1095D	probably benign	Het
Cpne1	G	T	2: 156,073,971	A433E	probably damaging	Het
Cyfip1	C	T	7: 55,928,284	L1181F	probably damaging	Het
Dnajc6	T	A	4: 101,612,930	I220N	probably damaging	Het
Duxbl1	G	C	14: 25,987,748		probably benign	Het
Fam135b	C	T	15: 71,463,911	R478H	probably benign	Het
Fam91a1	T	A	15: 58,450,600	S734T	possibly damaging	Het
Fut10	T	G	8: 31,236,467	S417A	probably benign	Het
Gm9945	C	T	11: 53,480,336		probably benign	Het
Golga4	A	G	9: 118,556,612	E934G	probably damaging	Het
Gpat2	G	A	2: 127,428,291	V75M	probably damaging	Het
Hdac5	A	G	11: 102,197,136	V949A	probably damaging	Het
Hdgfl1	G	T	13: 26,769,749	L114I	probably benign	Het
Ifi27l2b	T	A	12: 103,455,824	M94L	unknown	Het
Irs2	C	A	8: 11,005,352	A1027S	probably benign	Het
Itga2	A	T	13: 114,881,042	C111S	probably damaging	Het
Khdrbs1	T	C	4: 129,720,747	T338A	probably benign	Het
Klk1	T	C	7: 44,220,737		probably null	Het
Kmt2b	T	C	7: 30,576,068	N1822S	probably benign	Het
Lrig3	T	C	10: 125,994,441	I136T	probably benign	Het
Lyar	T	A	5: 38,227,932	D105E	probably benign	Het
Mat1a	T	A	14: 41,122,512	D366E	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Naip1	A	T	13: 100,423,219	D1092E	probably benign	Het
Neb	T	A	2: 52,249,511	K95*	probably null	Het
Nectin4	A	G	1: 171,380,208	D56G	probably benign	Het
Nupl1	A	T	14: 60,232,660	F334Y	probably damaging	Het
Olfr1502	A	G	19: 13,862,309	N172S	probably damaging	Het
Olfr294	A	T	7: 86,616,187	F153I	probably benign	Het
Ppp1r3a	A	T	6: 14,719,378	N512K	possibly damaging	Het
Pqlc2	A	G	4: 139,302,499	F74L	probably damaging	Het
Pramef8	A	G	4: 143,417,903	Q273R	possibly damaging	Het
Rad51ap2	A	G	12: 11,457,067	D330G	probably damaging	Het
Ren1	G	A	1: 133,360,124	A399T	probably damaging	Het
Rnft2	G	T	5: 118,194,605		probably benign	Het
Sept14	A	T	5: 129,699,035	S27T	probably benign	Het
Shox2	T	C	3: 66,978,359	K128E	possibly damaging	Het
Skint1	T	C	4: 112,025,481	W241R	probably benign	Het
Slc24a4	T	A	12: 102,222,051	H134Q	probably benign	Het
Slc25a36	A	T	9: 97,079,071	L165Q	possibly damaging	Het
Slc35f1	A	G	10: 53,073,534	I240V	probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tarbp2	A	G	15: 102,518,557	E3G	possibly damaging	Het
Tas2r130	A	T	6: 131,630,073	I253K	probably damaging	Het
Timm44	A	C	8: 4,266,588	C319G	probably null	Het
Tjap1	A	T	17: 46,260,095	N165K	probably damaging	Het
Tmem63b	A	G	17: 45,666,154	I429T	probably benign	Het
Trabd2b	A	T	4: 114,599,903	D339V	probably damaging	Het
Tst	T	C	15: 78,405,833	M1V	probably null	Het
Ube4a	A	T	9: 44,948,137	N335K	probably benign	Het
Vps54	C	T	11: 21,306,394	T633M	probably benign	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp953	A	G	13: 67,347,939	Y13H	probably damaging	Het

Other mutations in Pde8a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Pde8a	APN	7	81306708	missense	possibly damaging	0.62
IGL00808:Pde8a	APN	7	81283014	critical splice donor site	probably null
IGL01134:Pde8a	APN	7	81319078	missense	possibly damaging	0.86
IGL01443:Pde8a	APN	7	81324181	missense	probably damaging	1.00
IGL02044:Pde8a	APN	7	81317449	critical splice donor site	probably null
IGL02269:Pde8a	APN	7	81308802	splice site	probably benign
IGL02528:Pde8a	APN	7	81293189	splice site	probably benign
IGL02738:Pde8a	APN	7	81326342	missense	probably damaging	1.00
IGL02937:Pde8a	APN	7	81295771	splice site	probably benign
IGL03072:Pde8a	APN	7	81308809	missense	probably damaging	1.00
cast_iron	UTSW	7	81282807	splice site	probably null
K7894:Pde8a	UTSW	7	81306765	missense	probably damaging	1.00
R0069:Pde8a	UTSW	7	81319123	splice site	probably benign
R0069:Pde8a	UTSW	7	81319123	splice site	probably benign
R0547:Pde8a	UTSW	7	81324130	missense	probably benign	0.00
R0552:Pde8a	UTSW	7	81317347	missense	probably benign	0.12
R1342:Pde8a	UTSW	7	81302294	critical splice donor site	probably null
R1469:Pde8a	UTSW	7	81302271	missense	probably damaging	1.00
R1469:Pde8a	UTSW	7	81302271	missense	probably damaging	1.00
R1502:Pde8a	UTSW	7	81292259	missense	probably damaging	1.00
R1568:Pde8a	UTSW	7	81292263	missense	probably damaging	1.00
R1768:Pde8a	UTSW	7	81300723	splice site	probably null
R2076:Pde8a	UTSW	7	81308945	missense	probably benign	0.11
R2165:Pde8a	UTSW	7	81295768	critical splice donor site	probably null
R2385:Pde8a	UTSW	7	81282992	missense	probably benign	0.45
R4001:Pde8a	UTSW	7	81317356	missense	probably damaging	1.00
R4114:Pde8a	UTSW	7	81282807	splice site	probably null
R4115:Pde8a	UTSW	7	81282807	splice site	probably null
R4159:Pde8a	UTSW	7	81320659	missense	probably benign	0.13
R4299:Pde8a	UTSW	7	81328035	missense	probably benign
R4544:Pde8a	UTSW	7	81328099	missense	probably damaging	0.98
R4545:Pde8a	UTSW	7	81328099	missense	probably damaging	0.98
R4561:Pde8a	UTSW	7	81308820	nonsense	probably null
R4562:Pde8a	UTSW	7	81308820	nonsense	probably null
R4563:Pde8a	UTSW	7	81308820	nonsense	probably null
R4615:Pde8a	UTSW	7	81320737	missense	probably damaging	1.00
R4808:Pde8a	UTSW	7	81282931	missense	probably benign
R5396:Pde8a	UTSW	7	81333422	missense	probably damaging	1.00
R5840:Pde8a	UTSW	7	81213965	missense	probably benign
R5892:Pde8a	UTSW	7	81295691	missense	probably damaging	0.99
R6621:Pde8a	UTSW	7	81293130	critical splice acceptor site	probably null
R7067:Pde8a	UTSW	7	81317326	missense	probably benign	0.41
R7163:Pde8a	UTSW	7	81306708	missense	possibly damaging	0.62
R7483:Pde8a	UTSW	7	81282833	missense	probably benign	0.02
R7606:Pde8a	UTSW	7	81332967	missense	probably damaging	0.98
R7876:Pde8a	UTSW	7	81324071	missense	probably damaging	1.00
R8046:Pde8a	UTSW	7	81308839	missense	possibly damaging	0.90
R8046:Pde8a	UTSW	7	81317370	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CACAGACTATTATCAGCCTGACG -3'
(R):5'- GATGGGCTTACAGACATTAAGC -3'

Sequencing Primer
(F):5'- GCTCTCTGTTTCGAAGGTTACAGAAC -3'
(R):5'- TGGGCTTACAGACATTAAGCTATAG -3'

Posted On

2014-12-04