Incidental Mutation 'R2518:Olfr294'
ID254069
Institutional Source Beutler Lab
Gene Symbol Olfr294
Ensembl Gene ENSMUSG00000062042
Gene Nameolfactory receptor 294
SynonymsGA_x6K02T2NHDJ-9504525-9505532, MOR219-5
MMRRC Submission 040422-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R2518 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86615636-86616643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86616187 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 153 (F153I)
Ref Sequence ENSEMBL: ENSMUSP00000077662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078588]
Predicted Effect probably benign
Transcript: ENSMUST00000078588
AA Change: F153I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077662
Gene: ENSMUSG00000062042
AA Change: F153I

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 1.2e-38 PFAM
Pfam:7tm_1 39 288 1.8e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T A 2: 132,750,527 S165T probably damaging Het
Adam18 A G 8: 24,637,141 C480R probably damaging Het
Aftph G T 11: 20,725,797 T604K probably damaging Het
Bivm T C 1: 44,129,615 V279A probably damaging Het
C2cd2 G A 16: 97,922,086 T77I probably benign Het
Ccdc146 T C 5: 21,305,528 H527R probably benign Het
Cd226 A G 18: 89,207,327 N116S probably benign Het
Cit A G 5: 115,987,046 K1612E probably damaging Het
Cmtr1 T A 17: 29,681,980 Y663* probably null Het
Col3a1 T A 1: 45,337,512 probably benign Het
Copa A G 1: 172,119,901 N1095D probably benign Het
Cpne1 G T 2: 156,073,971 A433E probably damaging Het
Cyfip1 C T 7: 55,928,284 L1181F probably damaging Het
Dnajc6 T A 4: 101,612,930 I220N probably damaging Het
Duxbl1 G C 14: 25,987,748 probably benign Het
Fam135b C T 15: 71,463,911 R478H probably benign Het
Fam91a1 T A 15: 58,450,600 S734T possibly damaging Het
Fut10 T G 8: 31,236,467 S417A probably benign Het
Gm9945 C T 11: 53,480,336 probably benign Het
Golga4 A G 9: 118,556,612 E934G probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Hdac5 A G 11: 102,197,136 V949A probably damaging Het
Hdgfl1 G T 13: 26,769,749 L114I probably benign Het
Ifi27l2b T A 12: 103,455,824 M94L unknown Het
Irs2 C A 8: 11,005,352 A1027S probably benign Het
Itga2 A T 13: 114,881,042 C111S probably damaging Het
Khdrbs1 T C 4: 129,720,747 T338A probably benign Het
Klk1 T C 7: 44,220,737 probably null Het
Kmt2b T C 7: 30,576,068 N1822S probably benign Het
Lrig3 T C 10: 125,994,441 I136T probably benign Het
Lyar T A 5: 38,227,932 D105E probably benign Het
Mat1a T A 14: 41,122,512 D366E probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T A 2: 52,249,511 K95* probably null Het
Nectin4 A G 1: 171,380,208 D56G probably benign Het
Nupl1 A T 14: 60,232,660 F334Y probably damaging Het
Olfr1502 A G 19: 13,862,309 N172S probably damaging Het
Pde8a C A 7: 81,317,422 T437K probably benign Het
Ppp1r3a A T 6: 14,719,378 N512K possibly damaging Het
Pqlc2 A G 4: 139,302,499 F74L probably damaging Het
Pramef8 A G 4: 143,417,903 Q273R possibly damaging Het
Rad51ap2 A G 12: 11,457,067 D330G probably damaging Het
Ren1 G A 1: 133,360,124 A399T probably damaging Het
Rnft2 G T 5: 118,194,605 probably benign Het
Sept14 A T 5: 129,699,035 S27T probably benign Het
Shox2 T C 3: 66,978,359 K128E possibly damaging Het
Skint1 T C 4: 112,025,481 W241R probably benign Het
Slc24a4 T A 12: 102,222,051 H134Q probably benign Het
Slc25a36 A T 9: 97,079,071 L165Q possibly damaging Het
Slc35f1 A G 10: 53,073,534 I240V probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tarbp2 A G 15: 102,518,557 E3G possibly damaging Het
Tas2r130 A T 6: 131,630,073 I253K probably damaging Het
Timm44 A C 8: 4,266,588 C319G probably null Het
Tjap1 A T 17: 46,260,095 N165K probably damaging Het
Tmem63b A G 17: 45,666,154 I429T probably benign Het
Trabd2b A T 4: 114,599,903 D339V probably damaging Het
Tst T C 15: 78,405,833 M1V probably null Het
Ube4a A T 9: 44,948,137 N335K probably benign Het
Vps54 C T 11: 21,306,394 T633M probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp953 A G 13: 67,347,939 Y13H probably damaging Het
Other mutations in Olfr294
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Olfr294 APN 7 86615997 missense probably damaging 1.00
IGL02617:Olfr294 APN 7 86615664 missense probably benign 0.14
IGL02694:Olfr294 APN 7 86616310 missense probably benign 0.00
IGL02828:Olfr294 APN 7 86616069 missense possibly damaging 0.67
IGL03229:Olfr294 APN 7 86616078 missense probably benign 0.00
IGL03351:Olfr294 APN 7 86615677 missense possibly damaging 0.68
PIT4802001:Olfr294 UTSW 7 86616555 missense probably null 1.00
R0848:Olfr294 UTSW 7 86615640 missense probably damaging 0.96
R1448:Olfr294 UTSW 7 86616361 missense probably damaging 1.00
R1720:Olfr294 UTSW 7 86616456 missense probably damaging 1.00
R1734:Olfr294 UTSW 7 86616217 missense probably benign 0.07
R1959:Olfr294 UTSW 7 86616431 missense probably benign 0.00
R2116:Olfr294 UTSW 7 86616078 missense probably benign 0.00
R3034:Olfr294 UTSW 7 86615762 missense possibly damaging 0.50
R3110:Olfr294 UTSW 7 86615676 missense probably benign
R3112:Olfr294 UTSW 7 86615676 missense probably benign
R3690:Olfr294 UTSW 7 86616478 missense probably damaging 1.00
R4612:Olfr294 UTSW 7 86615736 missense probably benign 0.00
R6476:Olfr294 UTSW 7 86616010 missense probably benign 0.04
R6895:Olfr294 UTSW 7 86616115 missense probably damaging 1.00
R7102:Olfr294 UTSW 7 86616267 missense probably benign 0.25
R7104:Olfr294 UTSW 7 86615692 missense probably null 0.07
R7179:Olfr294 UTSW 7 86616366 missense possibly damaging 0.76
R7256:Olfr294 UTSW 7 86615665 missense probably benign 0.03
R7624:Olfr294 UTSW 7 86616561 missense possibly damaging 0.47
R8422:Olfr294 UTSW 7 86616258 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGGAATCTTCAGCACAGTGGAG -3'
(R):5'- TCACCCTGGATCTGAAACTCC -3'

Sequencing Primer
(F):5'- TCTTCAGCACAGTGGAGAAAATG -3'
(R):5'- ACACCCATGTACTTTTTCTTGAAG -3'
Posted On2014-12-04