Incidental Mutation 'R2762:En2'
ID 254082
Institutional Source Beutler Lab
Gene Symbol En2
Ensembl Gene ENSMUSG00000039095
Gene Name engrailed 2
Synonyms En-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock # R2762 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 28165694-28172166 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28170421 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 321 (S321P)
Ref Sequence ENSEMBL: ENSMUSP00000036761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036177]
AlphaFold P09066
Predicted Effect probably damaging
Transcript: ENSMUST00000036177
AA Change: S321P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036761
Gene: ENSMUSG00000039095
AA Change: S321P

DomainStartEndE-ValueType
low complexity region 21 39 N/A INTRINSIC
low complexity region 81 112 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
HOX 235 297 1.72e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199117
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: This locus affects anterior-posterior cerebellar patterning. Homozygous null mutants show altered foliation pattern and perform poorly in motor learning (rotarod) tests. Heterozygotes test intermediate on rotarod. Hypomorphs show no phenotypic effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,785,364 T288S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Baiap3 A G 17: 25,244,575 L909P probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
Dusp3 T C 11: 101,974,835 T178A probably benign Het
Ext1 G A 15: 53,344,927 S146L probably benign Het
Gm9923 C A 10: 72,309,630 H104N probably benign Het
Igtp A G 11: 58,206,065 M21V possibly damaging Het
Irs2 T C 8: 11,006,408 S675G probably damaging Het
Klhl36 T A 8: 119,869,974 L138Q probably damaging Het
Kmt2d T C 15: 98,852,055 probably benign Het
Nox3 A G 17: 3,696,158 V35A probably benign Het
Osbpl1a T C 18: 12,766,899 D274G possibly damaging Het
Plec C T 15: 76,172,286 G4349S probably damaging Het
Ppip5k2 A C 1: 97,717,509 S1073R probably damaging Het
Prkcq A G 2: 11,232,640 K77E possibly damaging Het
Prss1 T C 6: 41,463,281 V184A possibly damaging Het
Rnf111 T A 9: 70,476,045 H202L possibly damaging Het
S100pbp G A 4: 129,155,426 R308* probably null Het
Sgcb A T 5: 73,635,709 probably null Het
Spam1 T C 6: 24,796,643 F198L possibly damaging Het
Tbc1d4 A C 14: 101,494,361 C472G probably damaging Het
Tonsl T C 15: 76,630,620 N1128S probably damaging Het
Ttn C T 2: 76,798,103 R14571Q probably damaging Het
Tubb4a T A 17: 57,080,974 T351S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Wasl T C 6: 24,619,501 Y340C unknown Het
Other mutations in En2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02943:En2 APN 5 28166526 utr 5 prime probably benign
R0928:En2 UTSW 5 28170331 nonsense probably null
R2083:En2 UTSW 5 28167073 missense probably damaging 0.98
R2356:En2 UTSW 5 28166332 start gained probably benign
R5470:En2 UTSW 5 28166924 missense probably benign 0.03
R5760:En2 UTSW 5 28166999 missense probably benign 0.41
R6762:En2 UTSW 5 28170353 missense possibly damaging 0.65
R7640:En2 UTSW 5 28170166 nonsense probably null
R7687:En2 UTSW 5 28170289 missense probably damaging 1.00
R7827:En2 UTSW 5 28166596 missense probably benign
R8409:En2 UTSW 5 28166884 missense probably benign
R8861:En2 UTSW 5 28166735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTACCTGACAGAGCAG -3'
(R):5'- ACCCTAAACAGTCCCCTTTG -3'

Sequencing Primer
(F):5'- AGCGGCGCCAGAGTCTG -3'
(R):5'- GTCAGATTTTTGGATTTTACACCACC -3'
Posted On 2014-12-04