Incidental Mutation 'R2518:Hdac5'
ID254095
Institutional Source Beutler Lab
Gene Symbol Hdac5
Ensembl Gene ENSMUSG00000008855
Gene Namehistone deacetylase 5
SynonymsmHDA1
MMRRC Submission 040422-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2518 (G1)
Quality Score185
Status Not validated
Chromosome11
Chromosomal Location102194432-102230166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102197136 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 949 (V949A)
Ref Sequence ENSEMBL: ENSMUSP00000102770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008999] [ENSMUST00000070334] [ENSMUST00000078975] [ENSMUST00000107150] [ENSMUST00000107151] [ENSMUST00000107152] [ENSMUST00000124077] [ENSMUST00000140962]
Predicted Effect probably damaging
Transcript: ENSMUST00000008999
AA Change: V967A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000008999
Gene: ENSMUSG00000008855
AA Change: V967A

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Pfam:HDAC4_Gln 86 174 1e-30 PFAM
low complexity region 233 247 N/A INTRINSIC
low complexity region 322 337 N/A INTRINSIC
low complexity region 502 541 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
coiled coil region 583 617 N/A INTRINSIC
Pfam:Hist_deacetyl 704 1034 1.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070334
SMART Domains Protein: ENSMUSP00000064276
Gene: ENSMUSG00000034793

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078975
SMART Domains Protein: ENSMUSP00000077995
Gene: ENSMUSG00000034793

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107150
AA Change: V948A

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102768
Gene: ENSMUSG00000008855
AA Change: V948A

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
Pfam:HDAC4_Gln 66 155 5.1e-37 PFAM
low complexity region 214 228 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 483 522 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
coiled coil region 564 598 N/A INTRINSIC
Pfam:Hist_deacetyl 685 1015 9.4e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107151
AA Change: V864A

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102769
Gene: ENSMUSG00000008855
AA Change: V864A

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 1.1e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 618 931 1.2e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107152
AA Change: V949A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102770
Gene: ENSMUSG00000008855
AA Change: V949A

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 3.7e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 686 1016 6.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124077
SMART Domains Protein: ENSMUSP00000116672
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140481
Predicted Effect probably benign
Transcript: ENSMUST00000140962
SMART Domains Protein: ENSMUSP00000115435
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
PDB:2VQQ|B 1 71 3e-21 PDB
transmembrane domain 118 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155065
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the class II histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. It coimmunoprecipitates only with HDAC3 family member and might form multicomplex proteins. It also interacts with myocyte enhancer factor-2 (MEF2) proteins, resulting in repression of MEF2-dependent genes. This gene is thought to be associated with colon cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and display cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T A 2: 132,750,527 S165T probably damaging Het
Adam18 A G 8: 24,637,141 C480R probably damaging Het
Aftph G T 11: 20,725,797 T604K probably damaging Het
Bivm T C 1: 44,129,615 V279A probably damaging Het
C2cd2 G A 16: 97,922,086 T77I probably benign Het
Ccdc146 T C 5: 21,305,528 H527R probably benign Het
Cd226 A G 18: 89,207,327 N116S probably benign Het
Cit A G 5: 115,987,046 K1612E probably damaging Het
Cmtr1 T A 17: 29,681,980 Y663* probably null Het
Col3a1 T A 1: 45,337,512 probably benign Het
Copa A G 1: 172,119,901 N1095D probably benign Het
Cpne1 G T 2: 156,073,971 A433E probably damaging Het
Cyfip1 C T 7: 55,928,284 L1181F probably damaging Het
Dnajc6 T A 4: 101,612,930 I220N probably damaging Het
Duxbl1 G C 14: 25,987,748 probably benign Het
Fam135b C T 15: 71,463,911 R478H probably benign Het
Fam91a1 T A 15: 58,450,600 S734T possibly damaging Het
Fut10 T G 8: 31,236,467 S417A probably benign Het
Gm9945 C T 11: 53,480,336 probably benign Het
Golga4 A G 9: 118,556,612 E934G probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Hdgfl1 G T 13: 26,769,749 L114I probably benign Het
Ifi27l2b T A 12: 103,455,824 M94L unknown Het
Irs2 C A 8: 11,005,352 A1027S probably benign Het
Itga2 A T 13: 114,881,042 C111S probably damaging Het
Khdrbs1 T C 4: 129,720,747 T338A probably benign Het
Klk1 T C 7: 44,220,737 probably null Het
Kmt2b T C 7: 30,576,068 N1822S probably benign Het
Lrig3 T C 10: 125,994,441 I136T probably benign Het
Lyar T A 5: 38,227,932 D105E probably benign Het
Mat1a T A 14: 41,122,512 D366E probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T A 2: 52,249,511 K95* probably null Het
Nectin4 A G 1: 171,380,208 D56G probably benign Het
Nupl1 A T 14: 60,232,660 F334Y probably damaging Het
Olfr1502 A G 19: 13,862,309 N172S probably damaging Het
Olfr294 A T 7: 86,616,187 F153I probably benign Het
Pde8a C A 7: 81,317,422 T437K probably benign Het
Ppp1r3a A T 6: 14,719,378 N512K possibly damaging Het
Pqlc2 A G 4: 139,302,499 F74L probably damaging Het
Pramef8 A G 4: 143,417,903 Q273R possibly damaging Het
Rad51ap2 A G 12: 11,457,067 D330G probably damaging Het
Ren1 G A 1: 133,360,124 A399T probably damaging Het
Rnft2 G T 5: 118,194,605 probably benign Het
Sept14 A T 5: 129,699,035 S27T probably benign Het
Shox2 T C 3: 66,978,359 K128E possibly damaging Het
Skint1 T C 4: 112,025,481 W241R probably benign Het
Slc24a4 T A 12: 102,222,051 H134Q probably benign Het
Slc25a36 A T 9: 97,079,071 L165Q possibly damaging Het
Slc35f1 A G 10: 53,073,534 I240V probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tarbp2 A G 15: 102,518,557 E3G possibly damaging Het
Tas2r130 A T 6: 131,630,073 I253K probably damaging Het
Timm44 A C 8: 4,266,588 C319G probably null Het
Tjap1 A T 17: 46,260,095 N165K probably damaging Het
Tmem63b A G 17: 45,666,154 I429T probably benign Het
Trabd2b A T 4: 114,599,903 D339V probably damaging Het
Tst T C 15: 78,405,833 M1V probably null Het
Ube4a A T 9: 44,948,137 N335K probably benign Het
Vps54 C T 11: 21,306,394 T633M probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp953 A G 13: 67,347,939 Y13H probably damaging Het
Other mutations in Hdac5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hdac5 APN 11 102197342 missense probably damaging 1.00
IGL01614:Hdac5 APN 11 102200028 missense probably benign 0.38
IGL01799:Hdac5 APN 11 102200085 missense possibly damaging 0.71
IGL02839:Hdac5 APN 11 102204908 missense probably damaging 1.00
E0354:Hdac5 UTSW 11 102202146 unclassified probably benign
R0544:Hdac5 UTSW 11 102196096 missense probably damaging 1.00
R0612:Hdac5 UTSW 11 102196252 missense possibly damaging 0.92
R0632:Hdac5 UTSW 11 102205812 missense probably damaging 1.00
R0659:Hdac5 UTSW 11 102196024 missense probably damaging 1.00
R0930:Hdac5 UTSW 11 102204646 missense probably benign 0.02
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1475:Hdac5 UTSW 11 102202186 missense possibly damaging 0.94
R1491:Hdac5 UTSW 11 102201253 missense probably benign
R1596:Hdac5 UTSW 11 102204656 splice site probably null
R1673:Hdac5 UTSW 11 102198805 missense probably damaging 1.00
R1783:Hdac5 UTSW 11 102200516 missense probably benign
R1932:Hdac5 UTSW 11 102195872 splice site probably benign
R2197:Hdac5 UTSW 11 102204514 missense probably damaging 1.00
R2348:Hdac5 UTSW 11 102200014 missense probably benign 0.44
R3081:Hdac5 UTSW 11 102205610 missense probably damaging 1.00
R3622:Hdac5 UTSW 11 102195818 missense probably benign 0.34
R4543:Hdac5 UTSW 11 102213944 intron probably benign
R4559:Hdac5 UTSW 11 102199102 unclassified probably benign
R4661:Hdac5 UTSW 11 102205849 missense probably damaging 1.00
R4682:Hdac5 UTSW 11 102206630 missense probably null 0.99
R4708:Hdac5 UTSW 11 102202193 missense probably damaging 0.97
R4933:Hdac5 UTSW 11 102200563 unclassified probably benign
R4957:Hdac5 UTSW 11 102205256 unclassified probably benign
R4991:Hdac5 UTSW 11 102205624 missense probably damaging 1.00
R5090:Hdac5 UTSW 11 102197713 missense probably damaging 1.00
R5103:Hdac5 UTSW 11 102196283 missense probably damaging 0.98
R5330:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5331:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5386:Hdac5 UTSW 11 102202141 missense possibly damaging 0.71
R5449:Hdac5 UTSW 11 102196097 nonsense probably null
R5682:Hdac5 UTSW 11 102213923 intron probably benign
R6615:Hdac5 UTSW 11 102197056 splice site probably null
R6705:Hdac5 UTSW 11 102201236 missense probably damaging 0.99
R6875:Hdac5 UTSW 11 102202276 missense probably damaging 1.00
R6952:Hdac5 UTSW 11 102204960 missense probably benign
R7179:Hdac5 UTSW 11 102204559 missense possibly damaging 0.74
R7368:Hdac5 UTSW 11 102197381 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CAAGATGGCTCTAAGTCTTGCTC -3'
(R):5'- GTGGAATACCTGACAGCCTTC -3'

Sequencing Primer
(F):5'- AAGTCTTGCTCCCTGTAATGCTAAC -3'
(R):5'- CCTTCAGGTGGGGACTGAG -3'
Posted On2014-12-04