Mutagenetix > Incidental Mutations

Incidental Mutation 'R2762:Rnf111'

254103

Institutional Source

Beutler Lab

Gene Symbol

Rnf111

Ensembl Gene

ENSMUSG00000032217

Gene Name

ring finger 111

Synonyms

Arkadia

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2762 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70425424-70503725 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70476045 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 202 (H202L)

Ref Sequence

ENSEMBL: ENSMUSP00000149445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034739] [ENSMUST00000113595] [ENSMUST00000213647] [ENSMUST00000215848]

AlphaFold

Q99ML9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034739
AA Change: H202L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000034739
Gene: ENSMUSG00000032217
AA Change: H202L

Domain	Start	End	E-Value	Type
Pfam:RNF111_N	18	290	2.5e-112	PFAM
low complexity region	340	355	N/A	INTRINSIC
low complexity region	503	518	N/A	INTRINSIC
low complexity region	623	632	N/A	INTRINSIC
low complexity region	692	707	N/A	INTRINSIC
low complexity region	744	758	N/A	INTRINSIC
low complexity region	759	776	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
low complexity region	924	935	N/A	INTRINSIC
RING	937	977	3e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083268

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113595
AA Change: H202L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109225
Gene: ENSMUSG00000032217
AA Change: H202L

Domain	Start	End	E-Value	Type
Pfam:RNF111_N	18	290	1.8e-97	PFAM
low complexity region	340	355	N/A	INTRINSIC
low complexity region	503	518	N/A	INTRINSIC
low complexity region	623	632	N/A	INTRINSIC
low complexity region	692	707	N/A	INTRINSIC
low complexity region	744	758	N/A	INTRINSIC
low complexity region	759	776	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
low complexity region	924	935	N/A	INTRINSIC
RING	937	977	3e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213647
AA Change: H202L

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213694

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215848
AA Change: H202L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear RING-domain containing E3 ubiquitin ligase. This protein interacts with the transforming growth factor (TGF) -beta/NODAL signaling pathway by promoting the ubiquitination and proteosomal degradation of negative regulators, like SMAD proteins, and thereby enhances TGF-beta target-gene transcription. As a modulator of the nodal signaling cascade, this gene plays a critical role in the induction of mesoderm during embryonic development. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele fail to develop anterior structures and midline with failure to develop anterior endoderm, node and mesendoderm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak2	T	A	12: 112,785,364	T288S	probably damaging	Het
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Baiap3	A	G	17: 25,244,575	L909P	probably damaging	Het
Bicd1	C	T	6: 149,520,403	A874V	probably damaging	Het
Dusp3	T	C	11: 101,974,835	T178A	probably benign	Het
En2	T	C	5: 28,170,421	S321P	probably damaging	Het
Ext1	G	A	15: 53,344,927	S146L	probably benign	Het
Gm9923	C	A	10: 72,309,630	H104N	probably benign	Het
Igtp	A	G	11: 58,206,065	M21V	possibly damaging	Het
Irs2	T	C	8: 11,006,408	S675G	probably damaging	Het
Klhl36	T	A	8: 119,869,974	L138Q	probably damaging	Het
Kmt2d	T	C	15: 98,852,055		probably benign	Het
Nox3	A	G	17: 3,696,158	V35A	probably benign	Het
Osbpl1a	T	C	18: 12,766,899	D274G	possibly damaging	Het
Plec	C	T	15: 76,172,286	G4349S	probably damaging	Het
Ppip5k2	A	C	1: 97,717,509	S1073R	probably damaging	Het
Prkcq	A	G	2: 11,232,640	K77E	possibly damaging	Het
Prss1	T	C	6: 41,463,281	V184A	possibly damaging	Het
S100pbp	G	A	4: 129,155,426	R308*	probably null	Het
Sgcb	A	T	5: 73,635,709		probably null	Het
Spam1	T	C	6: 24,796,643	F198L	possibly damaging	Het
Tbc1d4	A	C	14: 101,494,361	C472G	probably damaging	Het
Tonsl	T	C	15: 76,630,620	N1128S	probably damaging	Het
Ttn	C	T	2: 76,798,103	R14571Q	probably damaging	Het
Tubb4a	T	A	17: 57,080,974	T351S	probably benign	Het
Ulk1	C	T	5: 110,789,357	R691Q	probably benign	Het
Wasl	T	C	6: 24,619,501	Y340C	unknown	Het

Other mutations in Rnf111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02473:Rnf111	APN	9	70440858	missense	probably damaging	1.00
IGL02567:Rnf111	APN	9	70459005	missense	probably damaging	1.00
R0052:Rnf111	UTSW	9	70476389	missense	probably benign	0.00
R0245:Rnf111	UTSW	9	70453831	splice site	probably benign
R0760:Rnf111	UTSW	9	70429678	missense	probably damaging	1.00
R1327:Rnf111	UTSW	9	70453816	missense	possibly damaging	0.60
R1778:Rnf111	UTSW	9	70476112	missense	probably benign	0.00
R1884:Rnf111	UTSW	9	70476238	missense	probably damaging	0.99
R1892:Rnf111	UTSW	9	70476374	missense	probably damaging	1.00
R2261:Rnf111	UTSW	9	70476391	missense	probably benign
R3980:Rnf111	UTSW	9	70442325	missense	probably damaging	1.00
R4577:Rnf111	UTSW	9	70429584	nonsense	probably null
R4631:Rnf111	UTSW	9	70450396	missense	probably benign	0.07
R4804:Rnf111	UTSW	9	70430957	missense	possibly damaging	0.70
R5153:Rnf111	UTSW	9	70476140	missense	probably benign	0.35
R5500:Rnf111	UTSW	9	70476043	missense	possibly damaging	0.94
R5546:Rnf111	UTSW	9	70459096	missense	probably benign	0.05
R5975:Rnf111	UTSW	9	70429580	missense	probably damaging	1.00
R6395:Rnf111	UTSW	9	70476410	missense	possibly damaging	0.95
R6482:Rnf111	UTSW	9	70429607	missense	probably damaging	1.00
R7056:Rnf111	UTSW	9	70453675	missense	possibly damaging	0.60
R7239:Rnf111	UTSW	9	70469373	missense	probably damaging	1.00
R7444:Rnf111	UTSW	9	70440843	missense	probably damaging	1.00
R7618:Rnf111	UTSW	9	70503332	start gained	probably benign
R8068:Rnf111	UTSW	9	70457941	missense	probably benign	0.00
R8323:Rnf111	UTSW	9	70475922	missense	probably benign	0.03
R8444:Rnf111	UTSW	9	70457941	missense	probably benign	0.00
R8997:Rnf111	UTSW	9	70476263	missense	probably damaging	0.98
R9108:Rnf111	UTSW	9	70429564	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGCTGCTGAGGTCATTCTC -3'
(R):5'- TGACTCTTCCTTAAGTGAGTGTC -3'

Sequencing Primer
(F):5'- CATTCTCACTGGAGCTACTGGAG -3'
(R):5'- CTCATCTAGTCTCCATTTTGGGGG -3'

Posted On

2014-12-04