Mutagenetix > Incidental Mutation

Incidental Mutation 'R2762:Ext1'

254117

Institutional Source

Beutler Lab

Gene Symbol

Ext1

Ensembl Gene

ENSMUSG00000061731

Gene Name

exostoses (multiple) 1

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2762 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53064038-53346159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 53344927 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 146 (S146L)

Ref Sequence

ENSEMBL: ENSMUSP00000076505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]

AlphaFold

P97464

Predicted Effect

probably benign
Transcript: ENSMUST00000077273
AA Change: S146L

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: S146L

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
low complexity region	29	41	N/A	INTRINSIC
Pfam:Exostosin	110	396	6e-64	PFAM
Pfam:Glyco_transf_64	480	729	1.1e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133362

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak2	T	A	12: 112,785,364	T288S	probably damaging	Het
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Baiap3	A	G	17: 25,244,575	L909P	probably damaging	Het
Bicd1	C	T	6: 149,520,403	A874V	probably damaging	Het
Dusp3	T	C	11: 101,974,835	T178A	probably benign	Het
En2	T	C	5: 28,170,421	S321P	probably damaging	Het
Gm9923	C	A	10: 72,309,630	H104N	probably benign	Het
Igtp	A	G	11: 58,206,065	M21V	possibly damaging	Het
Irs2	T	C	8: 11,006,408	S675G	probably damaging	Het
Klhl36	T	A	8: 119,869,974	L138Q	probably damaging	Het
Kmt2d	T	C	15: 98,852,055		probably benign	Het
Nox3	A	G	17: 3,696,158	V35A	probably benign	Het
Osbpl1a	T	C	18: 12,766,899	D274G	possibly damaging	Het
Plec	C	T	15: 76,172,286	G4349S	probably damaging	Het
Ppip5k2	A	C	1: 97,717,509	S1073R	probably damaging	Het
Prkcq	A	G	2: 11,232,640	K77E	possibly damaging	Het
Prss1	T	C	6: 41,463,281	V184A	possibly damaging	Het
Rnf111	T	A	9: 70,476,045	H202L	possibly damaging	Het
S100pbp	G	A	4: 129,155,426	R308*	probably null	Het
Sgcb	A	T	5: 73,635,709		probably null	Het
Spam1	T	C	6: 24,796,643	F198L	possibly damaging	Het
Tbc1d4	A	C	14: 101,494,361	C472G	probably damaging	Het
Tonsl	T	C	15: 76,630,620	N1128S	probably damaging	Het
Ttn	C	T	2: 76,798,103	R14571Q	probably damaging	Het
Tubb4a	T	A	17: 57,080,974	T351S	probably benign	Het
Ulk1	C	T	5: 110,789,357	R691Q	probably benign	Het
Wasl	T	C	6: 24,619,501	Y340C	unknown	Het

Other mutations in Ext1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00710:Ext1	APN	15	53344873	missense	probably damaging	1.00
IGL02081:Ext1	APN	15	53073446	nonsense	probably null
IGL03147:Ext1	UTSW	15	53088072	missense	probably damaging	0.98
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0437:Ext1	UTSW	15	53106106	missense	probably damaging	1.00
R0881:Ext1	UTSW	15	53344483	missense	probably benign	0.23
R1882:Ext1	UTSW	15	53075792	missense	probably damaging	1.00
R2135:Ext1	UTSW	15	53101744	missense	possibly damaging	0.88
R2175:Ext1	UTSW	15	53068728	missense	probably damaging	1.00
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3752:Ext1	UTSW	15	53075910	missense	probably damaging	1.00
R3815:Ext1	UTSW	15	53345089	missense	probably benign	0.05
R4096:Ext1	UTSW	15	53073357	missense	probably damaging	1.00
R4298:Ext1	UTSW	15	53345125	missense	probably benign	0.02
R4362:Ext1	UTSW	15	53107591	intron	probably benign
R4550:Ext1	UTSW	15	53101786	missense	probably damaging	0.99
R4647:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4648:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4871:Ext1	UTSW	15	53092377	missense	probably benign	0.37
R4954:Ext1	UTSW	15	53344492	missense	probably damaging	1.00
R5010:Ext1	UTSW	15	53092412	missense	probably damaging	1.00
R5153:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5155:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5328:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5385:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5542:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5555:Ext1	UTSW	15	53088143	missense	probably damaging	1.00
R5779:Ext1	UTSW	15	53344553	missense	probably damaging	0.99
R5874:Ext1	UTSW	15	53101752	missense	possibly damaging	0.61
R6401:Ext1	UTSW	15	53106097	missense	possibly damaging	0.94
R6604:Ext1	UTSW	15	53083159	missense	probably damaging	0.99
R6847:Ext1	UTSW	15	53345154	missense	probably benign
R6885:Ext1	UTSW	15	53101692	missense	probably damaging	1.00
R7212:Ext1	UTSW	15	53345162	missense	probably benign	0.00
R7315:Ext1	UTSW	15	53073387	missense	probably damaging	1.00
R7361:Ext1	UTSW	15	53344723	missense	probably damaging	1.00
R7474:Ext1	UTSW	15	53344489	missense	probably damaging	0.98
R7853:Ext1	UTSW	15	53107485	missense	probably damaging	0.96
R7860:Ext1	UTSW	15	53089939	missense	possibly damaging	0.84
R8013:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8014:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8725:Ext1	UTSW	15	53344669	missense	possibly damaging	0.91
R8888:Ext1	UTSW	15	53092327	missense	probably damaging	1.00
R9162:Ext1	UTSW	15	53345108	nonsense	probably null
R9342:Ext1	UTSW	15	53345128	missense	probably benign
R9587:Ext1	UTSW	15	53092412	missense	possibly damaging	0.53
R9663:Ext1	UTSW	15	53345060	missense	probably damaging	0.96
R9753:Ext1	UTSW	15	53344671	missense	probably damaging	1.00
X0021:Ext1	UTSW	15	53345273	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTCAGTGTAGTCAGGCCAAGTG -3'
(R):5'- AAACGAGGATTCCAGCGTGC -3'

Sequencing Primer
(F):5'- TGTGCACATACTGAGGTG -3'
(R):5'- GAGGATTCCAGCGTGCACATTTC -3'

Posted On

2014-12-04