Incidental Mutation 'R2518:Tarbp2'
ID254125
Institutional Source Beutler Lab
Gene Symbol Tarbp2
Ensembl Gene ENSMUSG00000023051
Gene NameTARBP2, RISC loading complex RNA binding subunit
SynonymsPrbp, TRBP
MMRRC Submission 040422-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock #R2518 (G1)
Quality Score185
Status Not validated
Chromosome15
Chromosomal Location102518192-102523676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102518557 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 3 (E3G)
Ref Sequence ENSEMBL: ENSMUSP00000023813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023812] [ENSMUST00000023813] [ENSMUST00000100168] [ENSMUST00000131184] [ENSMUST00000142114] [ENSMUST00000142194] [ENSMUST00000146756] [ENSMUST00000149200] [ENSMUST00000150393] [ENSMUST00000169377] [ENSMUST00000169367] [ENSMUST00000165174] [ENSMUST00000229805] [ENSMUST00000169162]
Predicted Effect probably benign
Transcript: ENSMUST00000023812
SMART Domains Protein: ENSMUSP00000023812
Gene: ENSMUSG00000023050

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000023813
AA Change: E3G

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023813
Gene: ENSMUSG00000023051
AA Change: E3G

DomainStartEndE-ValueType
DSRM 31 96 6.65e-25 SMART
low complexity region 105 121 N/A INTRINSIC
low complexity region 123 137 N/A INTRINSIC
DSRM 159 225 9.21e-19 SMART
DSRM 293 359 9.35e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000100168
AA Change: E3G
SMART Domains Protein: ENSMUSP00000097744
Gene: ENSMUSG00000023051
AA Change: E3G

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
DSRM 68 134 9.21e-19 SMART
DSRM 202 268 9.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131184
AA Change: E3G

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117964
Gene: ENSMUSG00000023051
AA Change: E3G

DomainStartEndE-ValueType
DSRM 31 77 1.45e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141266
Predicted Effect unknown
Transcript: ENSMUST00000142114
AA Change: E3G
SMART Domains Protein: ENSMUSP00000114953
Gene: ENSMUSG00000023051
AA Change: E3G

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142194
SMART Domains Protein: ENSMUSP00000123339
Gene: ENSMUSG00000023051

DomainStartEndE-ValueType
DSRM 10 75 6.65e-25 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
DSRM 138 204 9.21e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146756
SMART Domains Protein: ENSMUSP00000121748
Gene: ENSMUSG00000023051

DomainStartEndE-ValueType
DSRM 10 75 6.65e-25 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 102 116 N/A INTRINSIC
DSRM 138 204 9.21e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149200
SMART Domains Protein: ENSMUSP00000123213
Gene: ENSMUSG00000023051

DomainStartEndE-ValueType
DSRM 10 56 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150393
SMART Domains Protein: ENSMUSP00000120315
Gene: ENSMUSG00000023051

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 24 38 N/A INTRINSIC
PDB:2CPN|A 50 89 1e-22 PDB
Blast:DSRM 60 89 2e-14 BLAST
SCOP:d1di2a_ 60 89 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164343
Predicted Effect probably benign
Transcript: ENSMUST00000169377
SMART Domains Protein: ENSMUSP00000133209
Gene: ENSMUSG00000023050

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 159 397 1.2e-58 PFAM
Pfam:Pkinase_Tyr 160 397 3.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169367
Predicted Effect probably benign
Transcript: ENSMUST00000165174
Predicted Effect probably benign
Transcript: ENSMUST00000229805
Predicted Effect probably benign
Transcript: ENSMUST00000169162
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene binds between the bulge and the loop of the HIV-1 TAR RNA regulatory element and activates HIV-1 gene expression in synergy with the viral Tat protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene also has a pseudogene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in lethality at weaning, decreased body weight, and male infertility associated with oligozoospermia and failure of spermiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T A 2: 132,750,527 S165T probably damaging Het
Adam18 A G 8: 24,637,141 C480R probably damaging Het
Aftph G T 11: 20,725,797 T604K probably damaging Het
Bivm T C 1: 44,129,615 V279A probably damaging Het
C2cd2 G A 16: 97,922,086 T77I probably benign Het
Ccdc146 T C 5: 21,305,528 H527R probably benign Het
Cd226 A G 18: 89,207,327 N116S probably benign Het
Cit A G 5: 115,987,046 K1612E probably damaging Het
Cmtr1 T A 17: 29,681,980 Y663* probably null Het
Col3a1 T A 1: 45,337,512 probably benign Het
Copa A G 1: 172,119,901 N1095D probably benign Het
Cpne1 G T 2: 156,073,971 A433E probably damaging Het
Cyfip1 C T 7: 55,928,284 L1181F probably damaging Het
Dnajc6 T A 4: 101,612,930 I220N probably damaging Het
Duxbl1 G C 14: 25,987,748 probably benign Het
Fam135b C T 15: 71,463,911 R478H probably benign Het
Fam91a1 T A 15: 58,450,600 S734T possibly damaging Het
Fut10 T G 8: 31,236,467 S417A probably benign Het
Gm9945 C T 11: 53,480,336 probably benign Het
Golga4 A G 9: 118,556,612 E934G probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Hdac5 A G 11: 102,197,136 V949A probably damaging Het
Hdgfl1 G T 13: 26,769,749 L114I probably benign Het
Ifi27l2b T A 12: 103,455,824 M94L unknown Het
Irs2 C A 8: 11,005,352 A1027S probably benign Het
Itga2 A T 13: 114,881,042 C111S probably damaging Het
Khdrbs1 T C 4: 129,720,747 T338A probably benign Het
Klk1 T C 7: 44,220,737 probably null Het
Kmt2b T C 7: 30,576,068 N1822S probably benign Het
Lrig3 T C 10: 125,994,441 I136T probably benign Het
Lyar T A 5: 38,227,932 D105E probably benign Het
Mat1a T A 14: 41,122,512 D366E probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T A 2: 52,249,511 K95* probably null Het
Nectin4 A G 1: 171,380,208 D56G probably benign Het
Nupl1 A T 14: 60,232,660 F334Y probably damaging Het
Olfr1502 A G 19: 13,862,309 N172S probably damaging Het
Olfr294 A T 7: 86,616,187 F153I probably benign Het
Pde8a C A 7: 81,317,422 T437K probably benign Het
Ppp1r3a A T 6: 14,719,378 N512K possibly damaging Het
Pqlc2 A G 4: 139,302,499 F74L probably damaging Het
Pramef8 A G 4: 143,417,903 Q273R possibly damaging Het
Rad51ap2 A G 12: 11,457,067 D330G probably damaging Het
Ren1 G A 1: 133,360,124 A399T probably damaging Het
Rnft2 G T 5: 118,194,605 probably benign Het
Sept14 A T 5: 129,699,035 S27T probably benign Het
Shox2 T C 3: 66,978,359 K128E possibly damaging Het
Skint1 T C 4: 112,025,481 W241R probably benign Het
Slc24a4 T A 12: 102,222,051 H134Q probably benign Het
Slc25a36 A T 9: 97,079,071 L165Q possibly damaging Het
Slc35f1 A G 10: 53,073,534 I240V probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tas2r130 A T 6: 131,630,073 I253K probably damaging Het
Timm44 A C 8: 4,266,588 C319G probably null Het
Tjap1 A T 17: 46,260,095 N165K probably damaging Het
Tmem63b A G 17: 45,666,154 I429T probably benign Het
Trabd2b A T 4: 114,599,903 D339V probably damaging Het
Tst T C 15: 78,405,833 M1V probably null Het
Ube4a A T 9: 44,948,137 N335K probably benign Het
Vps54 C T 11: 21,306,394 T633M probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp953 A G 13: 67,347,939 Y13H probably damaging Het
Other mutations in Tarbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Tarbp2 APN 15 102521993 missense probably damaging 1.00
R6459:Tarbp2 UTSW 15 102518479 start gained probably benign
R7203:Tarbp2 UTSW 15 102522487 missense probably benign 0.22
R7478:Tarbp2 UTSW 15 102521734 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTAGCTCGGATCCATAAGAAGAC -3'
(R):5'- ACCCCAAACTAGAGCTGGAG -3'

Sequencing Primer
(F):5'- CTCGGATCCATAAGAAGACACAAGG -3'
(R):5'- ACAGCCCCAGTGCATGC -3'
Posted On2014-12-04