Incidental Mutation 'R2518:Tjap1'
ID254133
Institutional Source Beutler Lab
Gene Symbol Tjap1
Ensembl Gene ENSMUSG00000012296
Gene Nametight junction associated protein 1
Synonyms0610041D19Rik, Tjp4, Pilt
MMRRC Submission 040422-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R2518 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46257851-46283026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46260095 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 165 (N165K)
Ref Sequence ENSEMBL: ENSMUSP00000153632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012440] [ENSMUST00000095262] [ENSMUST00000164342] [ENSMUST00000180283] [ENSMUST00000224055] [ENSMUST00000224230] [ENSMUST00000224901] [ENSMUST00000225080] [ENSMUST00000225288] [ENSMUST00000225359] [ENSMUST00000225413] [ENSMUST00000225943]
Predicted Effect probably damaging
Transcript: ENSMUST00000012440
AA Change: N155K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012440
Gene: ENSMUSG00000012296
AA Change: N155K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 256 450 3.7e-83 PFAM
Pfam:Pilt 441 538 5.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095262
SMART Domains Protein: ENSMUSP00000092896
Gene: ENSMUSG00000071073

DomainStartEndE-ValueType
LRR 27 54 2.42e1 SMART
LRR 84 111 3.47e1 SMART
LRR 112 139 1.84e0 SMART
LRR 143 171 1.66e2 SMART
LRR 172 199 5.41e0 SMART
LRR 200 227 3.54e0 SMART
LRR 229 256 5.48e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164342
AA Change: N155K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130710
Gene: ENSMUSG00000012296
AA Change: N155K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 262 447 1.5e-59 PFAM
Pfam:Pilt 442 538 1.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180283
AA Change: N155K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137220
Gene: ENSMUSG00000012296
AA Change: N155K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 256 450 3.7e-83 PFAM
Pfam:Pilt 441 538 5.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224090
Predicted Effect probably benign
Transcript: ENSMUST00000224230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224696
Predicted Effect probably benign
Transcript: ENSMUST00000224901
Predicted Effect probably damaging
Transcript: ENSMUST00000225080
AA Change: N155K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225288
Predicted Effect probably benign
Transcript: ENSMUST00000225359
Predicted Effect probably damaging
Transcript: ENSMUST00000225413
AA Change: N165K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225915
Predicted Effect probably benign
Transcript: ENSMUST00000225943
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tight junction-associated protein. Incorporation of the encoded protein into tight junctions occurs at a late stage of formation of the junctions. The encoded protein localizes to the Golgi and may function in vesicle trafficking. Alternatively spliced transcript variants have been described. A related pseudogene exists on the X chromosome. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T A 2: 132,750,527 S165T probably damaging Het
Adam18 A G 8: 24,637,141 C480R probably damaging Het
Aftph G T 11: 20,725,797 T604K probably damaging Het
Bivm T C 1: 44,129,615 V279A probably damaging Het
C2cd2 G A 16: 97,922,086 T77I probably benign Het
Ccdc146 T C 5: 21,305,528 H527R probably benign Het
Cd226 A G 18: 89,207,327 N116S probably benign Het
Cit A G 5: 115,987,046 K1612E probably damaging Het
Cmtr1 T A 17: 29,681,980 Y663* probably null Het
Col3a1 T A 1: 45,337,512 probably benign Het
Copa A G 1: 172,119,901 N1095D probably benign Het
Cpne1 G T 2: 156,073,971 A433E probably damaging Het
Cyfip1 C T 7: 55,928,284 L1181F probably damaging Het
Dnajc6 T A 4: 101,612,930 I220N probably damaging Het
Duxbl1 G C 14: 25,987,748 probably benign Het
Fam135b C T 15: 71,463,911 R478H probably benign Het
Fam91a1 T A 15: 58,450,600 S734T possibly damaging Het
Fut10 T G 8: 31,236,467 S417A probably benign Het
Gm9945 C T 11: 53,480,336 probably benign Het
Golga4 A G 9: 118,556,612 E934G probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Hdac5 A G 11: 102,197,136 V949A probably damaging Het
Hdgfl1 G T 13: 26,769,749 L114I probably benign Het
Ifi27l2b T A 12: 103,455,824 M94L unknown Het
Irs2 C A 8: 11,005,352 A1027S probably benign Het
Itga2 A T 13: 114,881,042 C111S probably damaging Het
Khdrbs1 T C 4: 129,720,747 T338A probably benign Het
Klk1 T C 7: 44,220,737 probably null Het
Kmt2b T C 7: 30,576,068 N1822S probably benign Het
Lrig3 T C 10: 125,994,441 I136T probably benign Het
Lyar T A 5: 38,227,932 D105E probably benign Het
Mat1a T A 14: 41,122,512 D366E probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T A 2: 52,249,511 K95* probably null Het
Nectin4 A G 1: 171,380,208 D56G probably benign Het
Nupl1 A T 14: 60,232,660 F334Y probably damaging Het
Olfr1502 A G 19: 13,862,309 N172S probably damaging Het
Olfr294 A T 7: 86,616,187 F153I probably benign Het
Pde8a C A 7: 81,317,422 T437K probably benign Het
Ppp1r3a A T 6: 14,719,378 N512K possibly damaging Het
Pqlc2 A G 4: 139,302,499 F74L probably damaging Het
Pramef8 A G 4: 143,417,903 Q273R possibly damaging Het
Rad51ap2 A G 12: 11,457,067 D330G probably damaging Het
Ren1 G A 1: 133,360,124 A399T probably damaging Het
Rnft2 G T 5: 118,194,605 probably benign Het
Sept14 A T 5: 129,699,035 S27T probably benign Het
Shox2 T C 3: 66,978,359 K128E possibly damaging Het
Skint1 T C 4: 112,025,481 W241R probably benign Het
Slc24a4 T A 12: 102,222,051 H134Q probably benign Het
Slc25a36 A T 9: 97,079,071 L165Q possibly damaging Het
Slc35f1 A G 10: 53,073,534 I240V probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tarbp2 A G 15: 102,518,557 E3G possibly damaging Het
Tas2r130 A T 6: 131,630,073 I253K probably damaging Het
Timm44 A C 8: 4,266,588 C319G probably null Het
Tmem63b A G 17: 45,666,154 I429T probably benign Het
Trabd2b A T 4: 114,599,903 D339V probably damaging Het
Tst T C 15: 78,405,833 M1V probably null Het
Ube4a A T 9: 44,948,137 N335K probably benign Het
Vps54 C T 11: 21,306,394 T633M probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp953 A G 13: 67,347,939 Y13H probably damaging Het
Other mutations in Tjap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
I0000:Tjap1 UTSW 17 46259029 missense probably damaging 1.00
PIT4519001:Tjap1 UTSW 17 46261506 missense probably benign 0.09
R0087:Tjap1 UTSW 17 46263726 missense probably damaging 1.00
R0930:Tjap1 UTSW 17 46258529 missense possibly damaging 0.94
R1513:Tjap1 UTSW 17 46261442 missense probably benign 0.01
R1885:Tjap1 UTSW 17 46262421 missense probably damaging 1.00
R4523:Tjap1 UTSW 17 46258792 missense probably benign
R4552:Tjap1 UTSW 17 46260027 splice site probably null
R5452:Tjap1 UTSW 17 46260175 missense probably damaging 0.99
R5590:Tjap1 UTSW 17 46258871 missense probably damaging 1.00
R6600:Tjap1 UTSW 17 46259998 missense probably damaging 1.00
R7015:Tjap1 UTSW 17 46263774 missense possibly damaging 0.87
R7790:Tjap1 UTSW 17 46258690 missense probably benign 0.00
R8353:Tjap1 UTSW 17 46282604 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGACACAATCCTGAAGCGG -3'
(R):5'- TAGCACCTGTGGCCTTATGTC -3'

Sequencing Primer
(F):5'- AATCCTGAAGCGGCGGGAC -3'
(R):5'- CCTTATGTCTCTGGCTAGGAGAG -3'
Posted On2014-12-04