Incidental Mutation 'R2763:Calcrl'
ID254136
Institutional Source Beutler Lab
Gene Symbol Calcrl
Ensembl Gene ENSMUSG00000059588
Gene Namecalcitonin receptor-like
SynonymsCRLR
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2763 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84330626-84425411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84370503 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 66 (R66G)
Ref Sequence ENSEMBL: ENSMUSP00000097527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074262] [ENSMUST00000099944]
Predicted Effect probably damaging
Transcript: ENSMUST00000074262
AA Change: R66G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073875
Gene: ENSMUSG00000059588
AA Change: R66G

DomainStartEndE-ValueType
HormR 60 135 1.4e-26 SMART
Pfam:7tm_2 137 379 5.7e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099944
AA Change: R66G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097527
Gene: ENSMUSG00000059588
AA Change: R66G

DomainStartEndE-ValueType
HormR 60 135 1.4e-26 SMART
Pfam:7tm_2 137 379 3.2e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151295
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality between E13.5-E14.5, hydrops fetalis and cardiovascular defects such as thin vascular smooth muscle walls and small, disorganized hearts resulting from a decrease in cell proliferation and an increasein apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,227,670 D304V probably benign Het
Ablim3 T A 18: 61,813,544 K516* probably null Het
Akap11 A G 14: 78,518,892 F22S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ano7 A G 1: 93,399,186 probably null Het
Apol9a T C 15: 77,404,417 E250G probably benign Het
Camta2 G A 11: 70,682,530 Q187* probably null Het
Cd177 G A 7: 24,758,037 A193V probably benign Het
Cdk5rap2 A G 4: 70,281,271 V872A probably benign Het
Cebpz A G 17: 78,935,929 S99P probably benign Het
Cmtr1 G A 17: 29,680,628 E632K possibly damaging Het
Dysf A T 6: 84,106,932 H782L probably benign Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Golga3 T C 5: 110,204,895 I884T possibly damaging Het
Gstm6 G A 3: 107,941,042 T173M possibly damaging Het
Pcdhgb8 T A 18: 37,762,262 N128K probably damaging Het
Phkg2 A G 7: 127,579,833 E139G probably benign Het
Sdk1 T A 5: 142,084,551 V1157E possibly damaging Het
Sept9 C T 11: 117,326,501 T6I probably benign Het
Shkbp1 T A 7: 27,347,029 M437L probably benign Het
Svep1 A G 4: 58,084,061 C1904R possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Zfp646 T A 7: 127,880,038 C242* probably null Het
Other mutations in Calcrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Calcrl APN 2 84370454 missense probably benign 0.05
IGL01395:Calcrl APN 2 84368575 missense probably benign 0.25
IGL01672:Calcrl APN 2 84345070 missense probably damaging 1.00
IGL01738:Calcrl APN 2 84370449 missense probably benign 0.00
IGL01773:Calcrl APN 2 84370443 missense probably benign
IGL02007:Calcrl APN 2 84375324 missense probably benign
IGL02254:Calcrl APN 2 84348208 missense probably damaging 1.00
IGL02887:Calcrl APN 2 84339242 missense probably benign 0.04
R0008:Calcrl UTSW 2 84373274 missense probably benign 0.04
R0008:Calcrl UTSW 2 84373274 missense probably benign 0.04
R0485:Calcrl UTSW 2 84370091 missense probably benign 0.01
R1579:Calcrl UTSW 2 84333537 missense probably benign 0.00
R1640:Calcrl UTSW 2 84333677 missense probably damaging 0.98
R1694:Calcrl UTSW 2 84339287 missense probably damaging 1.00
R1731:Calcrl UTSW 2 84345168 critical splice donor site probably null
R1779:Calcrl UTSW 2 84351285 missense probably damaging 1.00
R1992:Calcrl UTSW 2 84370511 missense probably damaging 0.98
R2262:Calcrl UTSW 2 84345173 missense probably damaging 1.00
R3903:Calcrl UTSW 2 84368642 splice site probably benign
R4838:Calcrl UTSW 2 84351205 missense probably damaging 0.99
R4901:Calcrl UTSW 2 84333513 missense probably benign 0.00
R4997:Calcrl UTSW 2 84351248 nonsense probably null
R4998:Calcrl UTSW 2 84339314 missense probably damaging 1.00
R5791:Calcrl UTSW 2 84351265 missense probably damaging 1.00
R5887:Calcrl UTSW 2 84370497 missense probably damaging 1.00
R6046:Calcrl UTSW 2 84375314 missense probably benign 0.00
R6207:Calcrl UTSW 2 84333530 missense probably benign 0.00
R6959:Calcrl UTSW 2 84370084 missense possibly damaging 0.76
R6972:Calcrl UTSW 2 84368578 missense probably benign
R7522:Calcrl UTSW 2 84373364 missense probably benign
R7653:Calcrl UTSW 2 84345185 nonsense probably null
R7911:Calcrl UTSW 2 84351231 missense probably damaging 1.00
R8082:Calcrl UTSW 2 84370442 missense possibly damaging 0.56
R8110:Calcrl UTSW 2 84339339 missense probably damaging 1.00
R8152:Calcrl UTSW 2 84339249 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GAGGCTATTTTGTGACAAGTTCC -3'
(R):5'- CTTTCCAGCAAGGCACTGAG -3'

Sequencing Primer
(F):5'- GGCTATTTTGTGACAAGTTCCAAATG -3'
(R):5'- AGGCACTGAGAAGCCTTCCTTAG -3'
Posted On2014-12-04