Incidental Mutation 'R2763:Gstm6'
ID254138
Institutional Source Beutler Lab
Gene Symbol Gstm6
Ensembl Gene ENSMUSG00000068762
Gene Nameglutathione S-transferase, mu 6
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2763 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107938847-107943749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107941042 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 173 (T173M)
Ref Sequence ENSEMBL: ENSMUSP00000102296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106681] [ENSMUST00000106683] [ENSMUST00000106684] [ENSMUST00000106685] [ENSMUST00000155926]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106680
SMART Domains Protein: ENSMUSP00000102291
Gene: ENSMUSG00000068762

DomainStartEndE-ValueType
Pfam:GST_N 3 77 6.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106681
AA Change: T139M

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102292
Gene: ENSMUSG00000068762
AA Change: T139M

DomainStartEndE-ValueType
Pfam:GST_N 1 48 9.4e-12 PFAM
Pfam:GST_C_3 7 154 7.6e-11 PFAM
Pfam:GST_C 70 154 3.6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106683
AA Change: T78M

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102294
Gene: ENSMUSG00000068762
AA Change: T78M

DomainStartEndE-ValueType
Pfam:GST_C_3 4 95 6.3e-11 PFAM
Pfam:GST_C 6 97 2.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106684
AA Change: T187M

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102295
Gene: ENSMUSG00000068762
AA Change: T187M

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2e-22 PFAM
Pfam:GST_C_3 41 204 4.1e-12 PFAM
Pfam:GST_C 104 205 5.9e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106685
AA Change: T173M

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102296
Gene: ENSMUSG00000068762
AA Change: T173M

DomainStartEndE-ValueType
Pfam:GST_N 3 82 7.9e-23 PFAM
Pfam:GST_C 104 192 8.4e-20 PFAM
Pfam:GST_C_3 113 190 6.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155926
SMART Domains Protein: ENSMUSP00000139500
Gene: ENSMUSG00000068762

DomainStartEndE-ValueType
Pfam:GST_N 1 48 1.9e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,227,670 D304V probably benign Het
Ablim3 T A 18: 61,813,544 K516* probably null Het
Akap11 A G 14: 78,518,892 F22S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ano7 A G 1: 93,399,186 probably null Het
Apol9a T C 15: 77,404,417 E250G probably benign Het
Calcrl T C 2: 84,370,503 R66G probably damaging Het
Camta2 G A 11: 70,682,530 Q187* probably null Het
Cd177 G A 7: 24,758,037 A193V probably benign Het
Cdk5rap2 A G 4: 70,281,271 V872A probably benign Het
Cebpz A G 17: 78,935,929 S99P probably benign Het
Cmtr1 G A 17: 29,680,628 E632K possibly damaging Het
Dysf A T 6: 84,106,932 H782L probably benign Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Golga3 T C 5: 110,204,895 I884T possibly damaging Het
Pcdhgb8 T A 18: 37,762,262 N128K probably damaging Het
Phkg2 A G 7: 127,579,833 E139G probably benign Het
Sdk1 T A 5: 142,084,551 V1157E possibly damaging Het
Sept9 C T 11: 117,326,501 T6I probably benign Het
Shkbp1 T A 7: 27,347,029 M437L probably benign Het
Svep1 A G 4: 58,084,061 C1904R possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Zfp646 T A 7: 127,880,038 C242* probably null Het
Other mutations in Gstm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Gstm6 APN 3 107941063 missense probably benign 0.15
IGL02100:Gstm6 APN 3 107942337 missense probably benign 0.20
IGL02685:Gstm6 APN 3 107941191 missense probably benign 0.25
R1221:Gstm6 UTSW 3 107941102 missense probably damaging 1.00
R2428:Gstm6 UTSW 3 107943606 missense possibly damaging 0.82
R6178:Gstm6 UTSW 3 107941081 missense probably benign 0.01
R6545:Gstm6 UTSW 3 107942365 missense probably damaging 1.00
R6730:Gstm6 UTSW 3 107942725 nonsense probably null
X0018:Gstm6 UTSW 3 107942747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTGACAGCTAATTCTACCCAG -3'
(R):5'- CATGGTTTGCAGGGGACAAG -3'

Sequencing Primer
(F):5'- TTGACTCCGCAGATCTAGAAGGC -3'
(R):5'- TTTGCAGGGGACAAGGTAGAG -3'
Posted On2014-12-04