Incidental Mutation 'R0315:Gpbp1'
Institutional Source Beutler Lab
Gene Symbol Gpbp1
Ensembl Gene ENSMUSG00000032745
Gene NameGC-rich promoter binding protein 1
Synonyms1700034P14Rik, D230035M11Rik
MMRRC Submission 038525-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0315 (G1)
Quality Score225
Status Validated
Chromosomal Location111425680-111490111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 111436538 bp
Amino Acid Change Glutamic Acid to Alanine at position 360 (E360A)
Ref Sequence ENSEMBL: ENSMUSP00000048240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047627] [ENSMUST00000091236] [ENSMUST00000136471] [ENSMUST00000231096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047627
AA Change: E360A

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048240
Gene: ENSMUSG00000032745
AA Change: E360A

low complexity region 232 243 N/A INTRINSIC
Pfam:Vasculin 395 491 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091236
AA Change: E340A

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088777
Gene: ENSMUSG00000032745
AA Change: E340A

low complexity region 212 223 N/A INTRINSIC
Pfam:Vasculin 374 471 1.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129638
Predicted Effect probably benign
Transcript: ENSMUST00000136471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156221
Predicted Effect probably benign
Transcript: ENSMUST00000231096
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.9%
  • 20x: 88.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was originally isolated by subtractive hybridization of cDNAs expressed in atherosclerotic plaques with a thrombus, and was found to be expressed only in vascular smooth muscle cells. However, a shorter splice variant was found to be more ubiquitously expressed. This protein is suggested to play a role in the development of atherosclerosis. Studies in mice suggest that it may also function as a GC-rich promoter-specific trans-activating transcription factor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,515,452 R409Q possibly damaging Het
Ank3 A T 10: 70,002,517 Q825L probably damaging Het
Ap1g1 A G 8: 109,819,035 I107V probably benign Het
Bub1b A T 2: 118,626,976 probably benign Het
Cd86 C T 16: 36,620,944 V54I possibly damaging Het
Dpys T G 15: 39,857,338 I9L probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 G T 3: 93,214,722 G1400C unknown Het
Gm28042 T C 2: 120,039,057 L634P probably damaging Het
Gm6712 G A 17: 17,316,118 noncoding transcript Het
Hmgn1 A C 16: 96,124,817 I52R probably benign Het
Ing2 A C 8: 47,669,090 M141R probably benign Het
Klhl2 A T 8: 64,743,019 Y563* probably null Het
Lrrc9 A G 12: 72,456,028 T258A probably damaging Het
Map1b A T 13: 99,431,116 I1699N unknown Het
Map2k5 A T 9: 63,303,151 H185Q probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mroh1 C T 15: 76,427,600 A511V possibly damaging Het
Nop53 T C 7: 15,945,310 D90G probably damaging Het
Olfr1153 A T 2: 87,897,066 Y289F probably damaging Het
Olfr1447 A T 19: 12,901,234 V182D possibly damaging Het
Olfr370 T C 8: 83,541,372 V76A possibly damaging Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pkd2 T A 5: 104,459,850 S72T possibly damaging Het
Prc1 T C 7: 80,313,536 S587P probably damaging Het
Rdh7 G T 10: 127,888,396 T73K possibly damaging Het
Runx1 T C 16: 92,605,767 N429S probably damaging Het
Skint7 G A 4: 111,988,118 A376T possibly damaging Het
Slc16a14 T C 1: 84,912,496 I363V possibly damaging Het
Smarcal1 C T 1: 72,595,811 Q350* probably null Het
Soat1 T A 1: 156,440,513 K275* probably null Het
Speg T C 1: 75,415,136 V1571A possibly damaging Het
Stat5b G C 11: 100,788,460 D605E probably benign Het
Susd4 G A 1: 182,858,512 R209H probably benign Het
Tlr1 T G 5: 64,926,928 D102A probably damaging Het
Tm4sf5 A G 11: 70,510,636 N154D probably damaging Het
Tmigd3 T A 3: 105,916,769 M18K probably damaging Het
Ube2h A T 6: 30,241,413 V86E probably damaging Het
Utp20 A G 10: 88,807,421 L613P probably damaging Het
Vmn2r117 G A 17: 23,460,165 S695L probably benign Het
Washc5 T C 15: 59,341,976 D427G probably damaging Het
Zfp462 T A 4: 55,079,314 F2403I probably damaging Het
Other mutations in Gpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gpbp1 APN 13 111440750 missense probably damaging 0.96
IGL01360:Gpbp1 APN 13 111426541 utr 3 prime probably benign
IGL01609:Gpbp1 APN 13 111439202 missense possibly damaging 0.62
IGL01747:Gpbp1 APN 13 111453050 missense probably damaging 0.99
IGL02614:Gpbp1 APN 13 111436473 missense probably benign 0.01
IGL03329:Gpbp1 APN 13 111453253 splice site probably benign
R0510:Gpbp1 UTSW 13 111440745 missense possibly damaging 0.58
R1549:Gpbp1 UTSW 13 111436579 missense probably benign 0.00
R1582:Gpbp1 UTSW 13 111436532 splice site probably null
R1762:Gpbp1 UTSW 13 111440774 missense probably benign 0.02
R2074:Gpbp1 UTSW 13 111453407 missense probably benign 0.18
R2276:Gpbp1 UTSW 13 111466978 splice site probably null
R3685:Gpbp1 UTSW 13 111466871 missense probably benign 0.06
R4307:Gpbp1 UTSW 13 111448983 makesense probably null
R4408:Gpbp1 UTSW 13 111448964 missense possibly damaging 0.63
R4840:Gpbp1 UTSW 13 111440630 critical splice donor site probably null
R4952:Gpbp1 UTSW 13 111440750 missense probably damaging 0.96
R5152:Gpbp1 UTSW 13 111453281 intron probably benign
R5376:Gpbp1 UTSW 13 111426642 missense probably damaging 1.00
R6143:Gpbp1 UTSW 13 111466855 missense probably damaging 0.98
R6378:Gpbp1 UTSW 13 111433612 missense probably damaging 1.00
R6516:Gpbp1 UTSW 13 111453102 missense probably benign 0.05
R6687:Gpbp1 UTSW 13 111438085 missense possibly damaging 0.78
R6745:Gpbp1 UTSW 13 111453385 missense probably benign 0.05
R7186:Gpbp1 UTSW 13 111440699 missense possibly damaging 0.89
R7310:Gpbp1 UTSW 13 111453390 missense probably benign 0.02
R7669:Gpbp1 UTSW 13 111439124 missense probably benign 0.16
R7881:Gpbp1 UTSW 13 111439199 missense possibly damaging 0.45
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctgtagcctgtagcaggaag -3'
Posted On2013-04-16