Incidental Mutation 'R2763:Akap11'
ID254167
Institutional Source Beutler Lab
Gene Symbol Akap11
Ensembl Gene ENSMUSG00000022016
Gene NameA kinase (PRKA) anchor protein 11
Synonyms6330501D17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2763 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location78492246-78536808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78518892 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 22 (F22S)
Ref Sequence ENSEMBL: ENSMUSP00000116015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022593] [ENSMUST00000123853]
Predicted Effect probably damaging
Transcript: ENSMUST00000022593
AA Change: F22S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022593
Gene: ENSMUSG00000022016
AA Change: F22S

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1738 1755 N/A INTRINSIC
low complexity region 1767 1788 N/A INTRINSIC
Blast:AKAP_110 1790 1883 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000123853
AA Change: F22S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116015
Gene: ENSMUSG00000022016
AA Change: F22S

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1731 1756 N/A INTRINSIC
low complexity region 1768 1789 N/A INTRINSIC
Blast:AKAP_110 1791 1884 2e-8 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed at high levels throughout spermatogenesis and in mature sperm. It binds the RI and RII subunits of PKA in testis. It may serve a function in cell cycle control of both somatic cells and germ cells in addition to its putative role in spermatogenesis and sperm function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduction in body size, body length and tibia length, hypoactivity, slow movement and increased anxiety-related responses, and exhibit actin barrier defects in kidney collecting duct cells and increased urine osmolality in response to overhydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,227,670 D304V probably benign Het
Ablim3 T A 18: 61,813,544 K516* probably null Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ano7 A G 1: 93,399,186 probably null Het
Apol9a T C 15: 77,404,417 E250G probably benign Het
Calcrl T C 2: 84,370,503 R66G probably damaging Het
Camta2 G A 11: 70,682,530 Q187* probably null Het
Cd177 G A 7: 24,758,037 A193V probably benign Het
Cdk5rap2 A G 4: 70,281,271 V872A probably benign Het
Cebpz A G 17: 78,935,929 S99P probably benign Het
Cmtr1 G A 17: 29,680,628 E632K possibly damaging Het
Dysf A T 6: 84,106,932 H782L probably benign Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Golga3 T C 5: 110,204,895 I884T possibly damaging Het
Gstm6 G A 3: 107,941,042 T173M possibly damaging Het
Pcdhgb8 T A 18: 37,762,262 N128K probably damaging Het
Phkg2 A G 7: 127,579,833 E139G probably benign Het
Sdk1 T A 5: 142,084,551 V1157E possibly damaging Het
Sept9 C T 11: 117,326,501 T6I probably benign Het
Shkbp1 T A 7: 27,347,029 M437L probably benign Het
Svep1 A G 4: 58,084,061 C1904R possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Zfp646 T A 7: 127,880,038 C242* probably null Het
Other mutations in Akap11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Akap11 APN 14 78511341 missense probably damaging 1.00
IGL00902:Akap11 APN 14 78495838 missense probably benign 0.11
IGL01752:Akap11 APN 14 78509878 critical splice donor site probably null
IGL01972:Akap11 APN 14 78507857 missense probably damaging 0.99
IGL02031:Akap11 APN 14 78513813 missense possibly damaging 0.50
IGL02239:Akap11 APN 14 78513849 missense probably damaging 1.00
IGL02528:Akap11 APN 14 78510867 missense probably damaging 1.00
IGL02884:Akap11 APN 14 78498962 missense probably benign 0.02
IGL03130:Akap11 APN 14 78510368 nonsense probably null
IGL03179:Akap11 APN 14 78507740 missense probably benign 0.00
IGL03240:Akap11 APN 14 78495905 missense probably damaging 0.99
IGL03331:Akap11 APN 14 78513865 missense probably damaging 1.00
bonham UTSW 14 78498864 nonsense probably null
R0004:Akap11 UTSW 14 78514940 missense possibly damaging 0.65
R0020:Akap11 UTSW 14 78518177 missense probably benign 0.37
R0200:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0281:Akap11 UTSW 14 78510089 missense possibly damaging 0.84
R0320:Akap11 UTSW 14 78513379 missense probably benign
R0381:Akap11 UTSW 14 78513550 missense probably benign 0.01
R0536:Akap11 UTSW 14 78514024 missense probably damaging 1.00
R0608:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0735:Akap11 UTSW 14 78510078 missense probably damaging 1.00
R1189:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1400:Akap11 UTSW 14 78513962 missense probably damaging 1.00
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1501:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1588:Akap11 UTSW 14 78510245 missense possibly damaging 0.50
R1717:Akap11 UTSW 14 78513348 missense probably benign 0.02
R1823:Akap11 UTSW 14 78511488 missense probably damaging 1.00
R1847:Akap11 UTSW 14 78513661 missense probably benign 0.00
R1874:Akap11 UTSW 14 78511866 missense probably benign 0.14
R2031:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2032:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2276:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R4483:Akap11 UTSW 14 78510259 missense probably damaging 1.00
R4582:Akap11 UTSW 14 78511929 missense possibly damaging 0.81
R4857:Akap11 UTSW 14 78498860 missense probably damaging 0.99
R4922:Akap11 UTSW 14 78512780 nonsense probably null
R4993:Akap11 UTSW 14 78512968 missense probably damaging 1.00
R5426:Akap11 UTSW 14 78498864 nonsense probably null
R5472:Akap11 UTSW 14 78513429 missense probably benign 0.03
R5683:Akap11 UTSW 14 78512578 missense probably damaging 0.98
R5774:Akap11 UTSW 14 78510967 missense probably damaging 1.00
R6014:Akap11 UTSW 14 78512499 missense probably benign 0.00
R6264:Akap11 UTSW 14 78512421 missense possibly damaging 0.68
R6270:Akap11 UTSW 14 78518799 missense probably damaging 1.00
R6319:Akap11 UTSW 14 78513538 missense probably benign 0.06
R6376:Akap11 UTSW 14 78514896 missense probably damaging 1.00
R6394:Akap11 UTSW 14 78522589 critical splice donor site probably null
R6536:Akap11 UTSW 14 78511314 missense possibly damaging 0.81
R7048:Akap11 UTSW 14 78512514 missense
R7147:Akap11 UTSW 14 78511465 missense
R7473:Akap11 UTSW 14 78513888 missense
R7503:Akap11 UTSW 14 78512001 missense
R7542:Akap11 UTSW 14 78510292 missense
Predicted Primers PCR Primer
(F):5'- CTGCTTCCCAATCACTAGTATTATG -3'
(R):5'- TAAGTGAATCTGGAGTATAGGTCTG -3'

Sequencing Primer
(F):5'- GTACAGCTTTTAAAAACAGAGCCTG -3'
(R):5'- ATAGGTCTGTATTGTTTTCCAGGAAC -3'
Posted On2014-12-04