Incidental Mutation 'R2519:Lgalsl2'
ID 254197
Institutional Source Beutler Lab
Gene Symbol Lgalsl2
Ensembl Gene ENSMUSG00000048398
Gene Name galectin like 2
Synonyms Gm5065
MMRRC Submission 040423-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R2519 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 5353541-5363681 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 5362833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 155 (I155F)
Ref Sequence ENSEMBL: ENSMUSP00000146867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056639] [ENSMUST00000207531]
AlphaFold Q7TPX9
Predicted Effect probably damaging
Transcript: ENSMUST00000056639
AA Change: I155F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055799
Gene: ENSMUSG00000048398
AA Change: I155F

DomainStartEndE-ValueType
GLECT 31 165 1.56e-15 SMART
Gal-bind_lectin 37 165 2.51e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207531
AA Change: I155F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408J17Rik G A 10: 93,425,450 (GRCm39) probably benign Het
Abtb3 T A 10: 85,487,475 (GRCm39) V981D probably damaging Het
Actn1 A T 12: 80,239,163 (GRCm39) H247Q probably damaging Het
Adgre1 T C 17: 57,717,956 (GRCm39) C323R probably damaging Het
Adgrf2 T A 17: 43,021,298 (GRCm39) I509F probably damaging Het
Aknad1 A T 3: 108,663,784 (GRCm39) T331S probably damaging Het
Aldh1a3 T C 7: 66,072,047 (GRCm39) D39G probably benign Het
Alms1 C A 6: 85,644,945 (GRCm39) probably benign Het
Ankhd1 T G 18: 36,711,596 (GRCm39) probably null Het
Arfgef2 T C 2: 166,723,164 (GRCm39) S1535P probably benign Het
Bicc1 T C 10: 70,766,474 (GRCm39) E916G probably damaging Het
Birc2 A T 9: 7,821,180 (GRCm39) D381E possibly damaging Het
Carnmt1 A G 19: 18,671,075 (GRCm39) I316V probably benign Het
Cdk2ap1rt A G 11: 48,716,950 (GRCm39) I76T probably damaging Het
Chd6 T A 2: 160,871,796 (GRCm39) Y213F possibly damaging Het
Coq7 A T 7: 118,109,371 (GRCm39) W226R unknown Het
Cyp2d9 G A 15: 82,338,719 (GRCm39) probably null Het
Ddx42 T A 11: 106,136,155 (GRCm39) N635K probably damaging Het
Dmtf1 T C 5: 9,179,323 (GRCm39) T292A possibly damaging Het
Dnajb8 T C 6: 88,199,857 (GRCm39) V131A probably benign Het
Dock6 T C 9: 21,727,629 (GRCm39) E1367G possibly damaging Het
Dvl1 T A 4: 155,940,000 (GRCm39) Y377* probably null Het
Eif4g3 T A 4: 137,824,629 (GRCm39) F278Y probably benign Het
Fancg A T 4: 43,008,787 (GRCm39) L150H probably damaging Het
Fastkd5 T C 2: 130,458,114 (GRCm39) T159A possibly damaging Het
Fkrp G T 7: 16,544,877 (GRCm39) Y328* probably null Het
Fmo3 A T 1: 162,785,874 (GRCm39) V372D probably damaging Het
Gsta5 T G 9: 78,211,721 (GRCm39) L161R probably damaging Het
Gtf2h4 C A 17: 35,981,801 (GRCm39) G143W probably damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Hmcn1 A T 1: 150,649,571 (GRCm39) Y638* probably null Het
Ighv11-2 T A 12: 114,011,912 (GRCm39) Q101L probably damaging Het
Lipf G T 19: 33,942,925 (GRCm39) V78L probably damaging Het
Magi3 T C 3: 103,923,081 (GRCm39) E1212G probably benign Het
Mfap5 T C 6: 122,502,948 (GRCm39) S75P probably damaging Het
Mn1 C A 5: 111,566,418 (GRCm39) H129Q possibly damaging Het
Morc3 A G 16: 93,659,427 (GRCm39) probably null Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Myo5c A G 9: 75,157,718 (GRCm39) I224V probably damaging Het
Nup58 T C 14: 60,460,808 (GRCm39) T486A probably benign Het
Or5m13b A G 2: 85,753,951 (GRCm39) Y113C probably damaging Het
Or8b46 T A 9: 38,450,281 (GRCm39) V30D probably damaging Het
Parp14 A T 16: 35,678,573 (GRCm39) L465Q possibly damaging Het
Pcare C T 17: 72,058,642 (GRCm39) S345N probably damaging Het
Plcd3 A T 11: 102,971,226 (GRCm39) I110N possibly damaging Het
Prx A G 7: 27,217,668 (GRCm39) E862G probably benign Het
Rad50 G A 11: 53,598,012 (GRCm39) probably benign Het
Rbm15 A G 3: 107,238,149 (GRCm39) S750P probably benign Het
Reln C A 5: 22,549,367 (GRCm39) A14S unknown Het
Rph3a T C 5: 121,092,485 (GRCm39) Y372C probably damaging Het
Serpine2 T A 1: 79,777,256 (GRCm39) H187L possibly damaging Het
Slc11a2 T C 15: 100,299,204 (GRCm39) D122G probably damaging Het
Slc25a32 A T 15: 38,959,450 (GRCm39) V289E probably damaging Het
Slc25a46 A T 18: 31,735,814 (GRCm39) S142T probably benign Het
Srm A G 4: 148,675,961 (GRCm39) probably null Het
Srsf5 A G 12: 80,995,870 (GRCm39) D123G probably damaging Het
Stab1 A T 14: 30,876,829 (GRCm39) C832S probably damaging Het
Stab2 A C 10: 86,770,704 (GRCm39) probably benign Het
Suds3 T C 5: 117,233,018 (GRCm39) N282S probably damaging Het
Taar9 A T 10: 23,985,152 (GRCm39) V94E probably damaging Het
Taf2 C A 15: 54,915,643 (GRCm39) A428S probably benign Het
Tbk1 G T 10: 121,393,164 (GRCm39) T462K probably benign Het
Tcaf2 T G 6: 42,606,365 (GRCm39) I530L possibly damaging Het
Tigd4 A G 3: 84,501,221 (GRCm39) Y46C probably damaging Het
Topors G T 4: 40,261,714 (GRCm39) Y523* probably null Het
Tpte T C 8: 22,823,176 (GRCm39) probably benign Het
Trpv5 T A 6: 41,651,284 (GRCm39) Q254L probably damaging Het
Trpv6 G A 6: 41,601,550 (GRCm39) Q457* probably null Het
Ush2a A T 1: 187,999,304 (GRCm39) M205L probably benign Het
Vmn1r90 A T 7: 14,295,643 (GRCm39) Y152N probably damaging Het
Vmn2r124 T A 17: 18,294,280 (GRCm39) V789D probably damaging Het
Vmn2r99 T C 17: 19,598,970 (GRCm39) I218T probably damaging Het
Vstm2b T C 7: 40,552,299 (GRCm39) V248A probably benign Het
Wnk2 T C 13: 49,224,505 (GRCm39) K1019E probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zfp229 T A 17: 21,964,568 (GRCm39) F266Y possibly damaging Het
Zfp616 T A 11: 73,975,094 (GRCm39) C454* probably null Het
Other mutations in Lgalsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02060:Lgalsl2 APN 7 5,362,563 (GRCm39) missense probably damaging 0.99
IGL02147:Lgalsl2 APN 7 5,362,732 (GRCm39) missense probably damaging 1.00
R0771:Lgalsl2 UTSW 7 5,362,822 (GRCm39) missense probably damaging 1.00
R0906:Lgalsl2 UTSW 7 5,362,828 (GRCm39) missense probably damaging 0.99
R2018:Lgalsl2 UTSW 7 5,362,573 (GRCm39) missense probably benign 0.18
R2258:Lgalsl2 UTSW 7 5,362,401 (GRCm39) missense probably benign
R2865:Lgalsl2 UTSW 7 5,362,668 (GRCm39) missense probably benign 0.25
R5893:Lgalsl2 UTSW 7 5,362,623 (GRCm39) missense probably benign 0.00
R7485:Lgalsl2 UTSW 7 5,362,440 (GRCm39) missense probably benign 0.39
R7716:Lgalsl2 UTSW 7 5,362,819 (GRCm39) missense possibly damaging 0.56
R7836:Lgalsl2 UTSW 7 5,362,507 (GRCm39) missense probably damaging 1.00
R7898:Lgalsl2 UTSW 7 5,362,441 (GRCm39) missense probably benign 0.22
R8192:Lgalsl2 UTSW 7 5,362,595 (GRCm39) missense possibly damaging 0.77
R9324:Lgalsl2 UTSW 7 5,362,527 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGTATCTCAGGAGAAAGCGACG -3'
(R):5'- TCTTCTGGGCAAACCACAG -3'

Sequencing Primer
(F):5'- CGACGAAGAGAATTTGGCATTTCC -3'
(R):5'- CTTCTGGGCAAACCACAGATGAAG -3'
Posted On 2014-12-04