Incidental Mutation 'R2764:Mrps30'
ID254210
Institutional Source Beutler Lab
Gene Symbol Mrps30
Ensembl Gene ENSMUSG00000021731
Gene Namemitochondrial ribosomal protein S30
Synonyms2610020A16Rik, Pdcd9
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R2764 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location118378381-118387252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118384588 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 272 (Y272H)
Ref Sequence ENSEMBL: ENSMUSP00000022245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022245] [ENSMUST00000181168]
Predicted Effect probably benign
Transcript: ENSMUST00000022245
AA Change: Y272H

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022245
Gene: ENSMUSG00000021731
AA Change: Y272H

DomainStartEndE-ValueType
Pfam:PDCD9 1 423 1.7e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181168
SMART Domains Protein: ENSMUSP00000137680
Gene: ENSMUSG00000097411

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
low complexity region 117 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225170
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that is similar to the chicken pro-apoptotic protein p52. Transcript variants using alternative promoters or polyA sites have been mentioned in the literature but the complete description of these sequences is not available. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A T 8: 55,871,756 D554E probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Bcl2 C T 1: 106,712,436 E149K probably damaging Het
Clcn4 G T 7: 7,296,799 D10E possibly damaging Het
Efr3a T A 15: 65,849,770 F387L possibly damaging Het
Gm9923 C A 10: 72,309,630 H104N probably benign Het
Hmcn2 C T 2: 31,388,298 P1671S probably damaging Het
Htr1d G A 4: 136,443,065 A202T possibly damaging Het
Ighv9-3 T A 12: 114,140,870 Q58L probably damaging Het
Kat6a A G 8: 22,932,178 K835E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sipa1l2 T C 8: 125,492,374 M75V probably damaging Het
Ttn T A 2: 76,791,095 Y13921F probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vac14 T C 8: 110,710,455 F600S probably damaging Het
Other mutations in Mrps30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Mrps30 APN 13 118380610 missense probably damaging 1.00
R0030:Mrps30 UTSW 13 118382995 missense possibly damaging 0.94
R2439:Mrps30 UTSW 13 118385272 missense probably damaging 1.00
R4030:Mrps30 UTSW 13 118380541 missense probably damaging 1.00
R4231:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4232:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4234:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4235:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4236:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4625:Mrps30 UTSW 13 118386714 missense probably benign 0.14
R4935:Mrps30 UTSW 13 118386895 missense possibly damaging 0.82
R5363:Mrps30 UTSW 13 118387162 missense probably benign 0.39
R5986:Mrps30 UTSW 13 118384565 critical splice donor site probably null
R6566:Mrps30 UTSW 13 118387126 missense probably benign 0.00
R6681:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6694:Mrps30 UTSW 13 118386961 missense possibly damaging 0.82
R6699:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6700:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6788:Mrps30 UTSW 13 118380372 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGCAATATACCATCCTACGGTAG -3'
(R):5'- AGGCTCTGAATGTTCCCAAC -3'

Sequencing Primer
(F):5'- CTACGGTAGGAAGGGAAGAGGC -3'
(R):5'- ACACTTCAGACTTTTGATTCAGAG -3'
Posted On2014-12-04