Incidental Mutation 'R2519:Olfr910'
ID254215
Institutional Source Beutler Lab
Gene Symbol Olfr910
Ensembl Gene ENSMUSG00000060114
Gene Nameolfactory receptor 910
SynonymsMOR165-3, GA_x6K02T2PVTD-32239063-32239995
MMRRC Submission 040423-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2519 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38537849-38540820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38538985 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 30 (V30D)
Ref Sequence ENSEMBL: ENSMUSP00000149263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215122]
Predicted Effect probably damaging
Transcript: ENSMUST00000073214
AA Change: V30D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072947
Gene: ENSMUSG00000057444
AA Change: V30D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-49 PFAM
Pfam:7tm_1 41 290 4.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215122
AA Change: V30D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408J17Rik G A 10: 93,589,588 probably benign Het
Actn1 A T 12: 80,192,389 H247Q probably damaging Het
Adgre1 T C 17: 57,410,956 C323R probably damaging Het
Adgrf2 T A 17: 42,710,407 I509F probably damaging Het
Aknad1 A T 3: 108,756,468 T331S probably damaging Het
Aldh1a3 T C 7: 66,422,299 D39G probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankhd1 T G 18: 36,578,543 probably null Het
Arfgef2 T C 2: 166,881,244 S1535P probably benign Het
BC027072 C T 17: 71,751,647 S345N probably damaging Het
Bicc1 T C 10: 70,930,644 E916G probably damaging Het
Birc2 A T 9: 7,821,179 D381E possibly damaging Het
Btbd11 T A 10: 85,651,611 V981D probably damaging Het
Carnmt1 A G 19: 18,693,711 I316V probably benign Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Coq7 A T 7: 118,510,148 W226R unknown Het
Cyp2d9 G A 15: 82,454,518 probably null Het
Ddx42 T A 11: 106,245,329 N635K probably damaging Het
Dmtf1 T C 5: 9,129,323 T292A possibly damaging Het
Dnajb8 T C 6: 88,222,875 V131A probably benign Het
Dock6 T C 9: 21,816,333 E1367G possibly damaging Het
Dvl1 T A 4: 155,855,543 Y377* probably null Het
Eif4g3 T A 4: 138,097,318 F278Y probably benign Het
Fancg A T 4: 43,008,787 L150H probably damaging Het
Fastkd5 T C 2: 130,616,194 T159A possibly damaging Het
Fkrp G T 7: 16,810,952 Y328* probably null Het
Fmo3 A T 1: 162,958,305 V372D probably damaging Het
Gm10639 T G 9: 78,304,439 L161R probably damaging Het
Gm12184 A G 11: 48,826,123 I76T probably damaging Het
Gm5065 A T 7: 5,359,834 I155F probably damaging Het
Gtf2h4 C A 17: 35,670,909 G143W probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn1 A T 1: 150,773,820 Y638* probably null Het
Ighv11-2 T A 12: 114,048,292 Q101L probably damaging Het
Lipf G T 19: 33,965,525 V78L probably damaging Het
Magi3 T C 3: 104,015,765 E1212G probably benign Het
Mfap5 T C 6: 122,525,989 S75P probably damaging Het
Mn1 C A 5: 111,418,552 H129Q possibly damaging Het
Morc3 A G 16: 93,862,539 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c A G 9: 75,250,436 I224V probably damaging Het
Nupl1 T C 14: 60,223,359 T486A probably benign Het
Olfr1026 A G 2: 85,923,607 Y113C probably damaging Het
Parp14 A T 16: 35,858,203 L465Q possibly damaging Het
Plcd3 A T 11: 103,080,400 I110N possibly damaging Het
Prx A G 7: 27,518,243 E862G probably benign Het
Rad50 G A 11: 53,707,185 probably benign Het
Rbm15 A G 3: 107,330,833 S750P probably benign Het
Reln C A 5: 22,344,369 A14S unknown Het
Rph3a T C 5: 120,954,422 Y372C probably damaging Het
Serpine2 T A 1: 79,799,539 H187L possibly damaging Het
Slc11a2 T C 15: 100,401,323 D122G probably damaging Het
Slc25a32 A T 15: 39,096,055 V289E probably damaging Het
Slc25a46 A T 18: 31,602,761 S142T probably benign Het
Srm A G 4: 148,591,504 probably null Het
Srsf5 A G 12: 80,949,096 D123G probably damaging Het
Stab1 A T 14: 31,154,872 C832S probably damaging Het
Stab2 A C 10: 86,934,840 probably benign Het
Suds3 T C 5: 117,094,953 N282S probably damaging Het
Taar9 A T 10: 24,109,254 V94E probably damaging Het
Taf2 C A 15: 55,052,247 A428S probably benign Het
Tbk1 G T 10: 121,557,259 T462K probably benign Het
Tcaf2 T G 6: 42,629,431 I530L possibly damaging Het
Tigd4 A G 3: 84,593,914 Y46C probably damaging Het
Topors G T 4: 40,261,714 Y523* probably null Het
Tpte T C 8: 22,333,160 probably benign Het
Trpv5 T A 6: 41,674,350 Q254L probably damaging Het
Trpv6 G A 6: 41,624,616 Q457* probably null Het
Ush2a A T 1: 188,267,107 M205L probably benign Het
Vmn1r90 A T 7: 14,561,718 Y152N probably damaging Het
Vmn2r124 T A 17: 18,074,018 V789D probably damaging Het
Vmn2r99 T C 17: 19,378,708 I218T probably damaging Het
Vstm2b T C 7: 40,902,875 V248A probably benign Het
Wnk2 T C 13: 49,071,029 K1019E probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp229 T A 17: 21,745,587 F266Y possibly damaging Het
Zfp616 T A 11: 74,084,268 C454* probably null Het
Other mutations in Olfr910
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02740:Olfr910 APN 9 38538930 missense probably damaging 1.00
R0096:Olfr910 UTSW 9 38539536 missense probably damaging 0.96
R0550:Olfr910 UTSW 9 38539380 missense probably damaging 0.97
R1375:Olfr910 UTSW 9 38539534 missense possibly damaging 0.63
R1698:Olfr910 UTSW 9 38539256 nonsense probably null
R2067:Olfr910 UTSW 9 38539280 missense probably benign 0.09
R2111:Olfr910 UTSW 9 38539280 missense probably benign 0.09
R4742:Olfr910 UTSW 9 38539656 missense probably damaging 1.00
R4782:Olfr910 UTSW 9 38539075 missense probably damaging 1.00
R6491:Olfr910 UTSW 9 38647455 missense probably damaging 1.00
R7101:Olfr910 UTSW 9 38539670 missense probably benign 0.02
R8108:Olfr910 UTSW 9 38539410 missense probably damaging 0.97
R8270:Olfr910 UTSW 9 38539348 missense noncoding transcript
Z1088:Olfr910 UTSW 9 38539149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTCTCATGTATGGGAGAAC -3'
(R):5'- GAGTTGAGTCATACATCCCGC -3'

Sequencing Primer
(F):5'- CAAACAGTAGTAAAGTCTCTGTGAC -3'
(R):5'- GAGTTGAGTCATACATCCCGCAAAAC -3'
Posted On2014-12-04