Incidental Mutation 'R2829:Cylc2'
ID254219
Institutional Source Beutler Lab
Gene Symbol Cylc2
Ensembl Gene ENSMUSG00000039555
Gene Namecylicin, basic protein of sperm head cytoskeleton 2
Synonyms4930488P18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2829 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location51216678-51230272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51229798 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 380 (D380G)
Ref Sequence ENSEMBL: ENSMUSP00000125758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041392] [ENSMUST00000166749]
Predicted Effect unknown
Transcript: ENSMUST00000041392
AA Change: D380G
SMART Domains Protein: ENSMUSP00000039750
Gene: ENSMUSG00000039555
AA Change: D380G

DomainStartEndE-ValueType
Pfam:Cylicin_N 7 115 1.1e-43 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156384
Predicted Effect unknown
Transcript: ENSMUST00000166749
AA Change: D380G
SMART Domains Protein: ENSMUSP00000125758
Gene: ENSMUSG00000039555
AA Change: D380G

DomainStartEndE-ValueType
Pfam:Cylicin_N 8 113 4.6e-46 PFAM
low complexity region 122 131 N/A INTRINSIC
low complexity region 174 220 N/A INTRINSIC
low complexity region 224 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 338 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 9 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 T C 10: 89,112,939 E103G possibly damaging Het
Arid2 C T 15: 96,369,454 P605L possibly damaging Het
Cts6 T A 13: 61,201,497 R132S probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gabra5 A G 7: 57,490,835 V38A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc8b1 T C 5: 120,524,013 S256P probably benign Het
Uggt1 T C 1: 36,162,294 T1122A probably benign Het
Vmn2r54 T C 7: 12,615,690 D655G possibly damaging Het
Other mutations in Cylc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Cylc2 APN 4 51228157 missense probably damaging 1.00
IGL01669:Cylc2 APN 4 51228360 missense probably benign 0.01
IGL02662:Cylc2 APN 4 51216698 utr 5 prime probably benign
R0277:Cylc2 UTSW 4 51228477 missense unknown
R0323:Cylc2 UTSW 4 51228477 missense unknown
R0968:Cylc2 UTSW 4 51216706 start codon destroyed probably null 0.50
R1395:Cylc2 UTSW 4 51228366 missense possibly damaging 0.53
R1639:Cylc2 UTSW 4 51228310 missense probably benign 0.23
R1643:Cylc2 UTSW 4 51225173 missense probably benign 0.38
R4464:Cylc2 UTSW 4 51229651 missense unknown
R4467:Cylc2 UTSW 4 51229651 missense unknown
R4496:Cylc2 UTSW 4 51229651 missense unknown
R4505:Cylc2 UTSW 4 51229651 missense unknown
R4514:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229651 missense unknown
R4546:Cylc2 UTSW 4 51229840 missense unknown
R4654:Cylc2 UTSW 4 51228279 missense probably benign 0.00
R4949:Cylc2 UTSW 4 51229804 missense unknown
R5141:Cylc2 UTSW 4 51228587 intron probably benign
R5176:Cylc2 UTSW 4 51228587 intron probably benign
R5177:Cylc2 UTSW 4 51228587 intron probably benign
R5179:Cylc2 UTSW 4 51228587 intron probably benign
R7469:Cylc2 UTSW 4 51227970 intron probably null
R7508:Cylc2 UTSW 4 51229256 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACACTTTTAAGTACAGCAGCTGAC -3'
(R):5'- GGAGTTCTTACCTTCAGTTTGC -3'

Sequencing Primer
(F):5'- TTTAAGTACAGCAGCTGACAAAGATG -3'
(R):5'- CAGTTTGCTTTTTGAACCAAGACC -3'
Posted On2014-12-04