Incidental Mutation 'R2519:Mrc2'
ID254238
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
MMRRC Submission 040423-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2519 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 105348431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect probably benign
Transcript: ENSMUST00000021038
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100335
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408J17Rik G A 10: 93,589,588 probably benign Het
Actn1 A T 12: 80,192,389 H247Q probably damaging Het
Adgre1 T C 17: 57,410,956 C323R probably damaging Het
Adgrf2 T A 17: 42,710,407 I509F probably damaging Het
Aknad1 A T 3: 108,756,468 T331S probably damaging Het
Aldh1a3 T C 7: 66,422,299 D39G probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankhd1 T G 18: 36,578,543 probably null Het
Arfgef2 T C 2: 166,881,244 S1535P probably benign Het
BC027072 C T 17: 71,751,647 S345N probably damaging Het
Bicc1 T C 10: 70,930,644 E916G probably damaging Het
Birc2 A T 9: 7,821,179 D381E possibly damaging Het
Btbd11 T A 10: 85,651,611 V981D probably damaging Het
Carnmt1 A G 19: 18,693,711 I316V probably benign Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Coq7 A T 7: 118,510,148 W226R unknown Het
Cyp2d9 G A 15: 82,454,518 probably null Het
Ddx42 T A 11: 106,245,329 N635K probably damaging Het
Dmtf1 T C 5: 9,129,323 T292A possibly damaging Het
Dnajb8 T C 6: 88,222,875 V131A probably benign Het
Dock6 T C 9: 21,816,333 E1367G possibly damaging Het
Dvl1 T A 4: 155,855,543 Y377* probably null Het
Eif4g3 T A 4: 138,097,318 F278Y probably benign Het
Fancg A T 4: 43,008,787 L150H probably damaging Het
Fastkd5 T C 2: 130,616,194 T159A possibly damaging Het
Fkrp G T 7: 16,810,952 Y328* probably null Het
Fmo3 A T 1: 162,958,305 V372D probably damaging Het
Gm10639 T G 9: 78,304,439 L161R probably damaging Het
Gm12184 A G 11: 48,826,123 I76T probably damaging Het
Gm5065 A T 7: 5,359,834 I155F probably damaging Het
Gtf2h4 C A 17: 35,670,909 G143W probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn1 A T 1: 150,773,820 Y638* probably null Het
Ighv11-2 T A 12: 114,048,292 Q101L probably damaging Het
Lipf G T 19: 33,965,525 V78L probably damaging Het
Magi3 T C 3: 104,015,765 E1212G probably benign Het
Mfap5 T C 6: 122,525,989 S75P probably damaging Het
Mn1 C A 5: 111,418,552 H129Q possibly damaging Het
Morc3 A G 16: 93,862,539 probably null Het
Myo5c A G 9: 75,250,436 I224V probably damaging Het
Nupl1 T C 14: 60,223,359 T486A probably benign Het
Olfr1026 A G 2: 85,923,607 Y113C probably damaging Het
Olfr910 T A 9: 38,538,985 V30D probably damaging Het
Parp14 A T 16: 35,858,203 L465Q possibly damaging Het
Plcd3 A T 11: 103,080,400 I110N possibly damaging Het
Prx A G 7: 27,518,243 E862G probably benign Het
Rad50 G A 11: 53,707,185 probably benign Het
Rbm15 A G 3: 107,330,833 S750P probably benign Het
Reln C A 5: 22,344,369 A14S unknown Het
Rph3a T C 5: 120,954,422 Y372C probably damaging Het
Serpine2 T A 1: 79,799,539 H187L possibly damaging Het
Slc11a2 T C 15: 100,401,323 D122G probably damaging Het
Slc25a32 A T 15: 39,096,055 V289E probably damaging Het
Slc25a46 A T 18: 31,602,761 S142T probably benign Het
Srm A G 4: 148,591,504 probably null Het
Srsf5 A G 12: 80,949,096 D123G probably damaging Het
Stab1 A T 14: 31,154,872 C832S probably damaging Het
Stab2 A C 10: 86,934,840 probably benign Het
Suds3 T C 5: 117,094,953 N282S probably damaging Het
Taar9 A T 10: 24,109,254 V94E probably damaging Het
Taf2 C A 15: 55,052,247 A428S probably benign Het
Tbk1 G T 10: 121,557,259 T462K probably benign Het
Tcaf2 T G 6: 42,629,431 I530L possibly damaging Het
Tigd4 A G 3: 84,593,914 Y46C probably damaging Het
Topors G T 4: 40,261,714 Y523* probably null Het
Tpte T C 8: 22,333,160 probably benign Het
Trpv5 T A 6: 41,674,350 Q254L probably damaging Het
Trpv6 G A 6: 41,624,616 Q457* probably null Het
Ush2a A T 1: 188,267,107 M205L probably benign Het
Vmn1r90 A T 7: 14,561,718 Y152N probably damaging Het
Vmn2r124 T A 17: 18,074,018 V789D probably damaging Het
Vmn2r99 T C 17: 19,378,708 I218T probably damaging Het
Vstm2b T C 7: 40,902,875 V248A probably benign Het
Wnk2 T C 13: 49,071,029 K1019E probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp229 T A 17: 21,745,587 F266Y possibly damaging Het
Zfp616 T A 11: 74,084,268 C454* probably null Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
R7537:Mrc2 UTSW 11 105292797 missense probably benign
R7640:Mrc2 UTSW 11 105332295 missense possibly damaging 0.48
R7709:Mrc2 UTSW 11 105346459 missense probably benign 0.10
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTTGAGCTGCCAGAGAAGAG -3'
(R):5'- CTGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'
Posted On2014-12-04