Incidental Mutation 'R2519:Ddx42'
ID254240
Institutional Source Beutler Lab
Gene Symbol Ddx42
Ensembl Gene ENSMUSG00000020705
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 42
SynonymsB430002H05Rik, SF3b125, 1810047H21Rik
MMRRC Submission 040423-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2519 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106216926-106249139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106245329 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 635 (N635K)
Ref Sequence ENSEMBL: ENSMUSP00000021046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021046] [ENSMUST00000021048]
Predicted Effect probably damaging
Transcript: ENSMUST00000021046
AA Change: N635K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021046
Gene: ENSMUSG00000020705
AA Change: N635K

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 108 114 N/A INTRINSIC
coiled coil region 116 143 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
DEXDc 272 474 7.61e-68 SMART
HELICc 512 593 1.58e-33 SMART
low complexity region 644 659 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 814 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021048
SMART Domains Protein: ENSMUSP00000021048
Gene: ENSMUSG00000020706

DomainStartEndE-ValueType
Pfam:FtsJ 24 200 2.8e-56 PFAM
low complexity region 203 218 N/A INTRINSIC
Pfam:DUF3381 231 398 1.3e-48 PFAM
low complexity region 456 475 N/A INTRINSIC
low complexity region 560 568 N/A INTRINSIC
Pfam:Spb1_C 597 831 1.8e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126938
Meta Mutation Damage Score 0.2586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408J17Rik G A 10: 93,589,588 probably benign Het
Actn1 A T 12: 80,192,389 H247Q probably damaging Het
Adgre1 T C 17: 57,410,956 C323R probably damaging Het
Adgrf2 T A 17: 42,710,407 I509F probably damaging Het
Aknad1 A T 3: 108,756,468 T331S probably damaging Het
Aldh1a3 T C 7: 66,422,299 D39G probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankhd1 T G 18: 36,578,543 probably null Het
Arfgef2 T C 2: 166,881,244 S1535P probably benign Het
BC027072 C T 17: 71,751,647 S345N probably damaging Het
Bicc1 T C 10: 70,930,644 E916G probably damaging Het
Birc2 A T 9: 7,821,179 D381E possibly damaging Het
Btbd11 T A 10: 85,651,611 V981D probably damaging Het
Carnmt1 A G 19: 18,693,711 I316V probably benign Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Coq7 A T 7: 118,510,148 W226R unknown Het
Cyp2d9 G A 15: 82,454,518 probably null Het
Dmtf1 T C 5: 9,129,323 T292A possibly damaging Het
Dnajb8 T C 6: 88,222,875 V131A probably benign Het
Dock6 T C 9: 21,816,333 E1367G possibly damaging Het
Dvl1 T A 4: 155,855,543 Y377* probably null Het
Eif4g3 T A 4: 138,097,318 F278Y probably benign Het
Fancg A T 4: 43,008,787 L150H probably damaging Het
Fastkd5 T C 2: 130,616,194 T159A possibly damaging Het
Fkrp G T 7: 16,810,952 Y328* probably null Het
Fmo3 A T 1: 162,958,305 V372D probably damaging Het
Gm10639 T G 9: 78,304,439 L161R probably damaging Het
Gm12184 A G 11: 48,826,123 I76T probably damaging Het
Gm5065 A T 7: 5,359,834 I155F probably damaging Het
Gtf2h4 C A 17: 35,670,909 G143W probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn1 A T 1: 150,773,820 Y638* probably null Het
Ighv11-2 T A 12: 114,048,292 Q101L probably damaging Het
Lipf G T 19: 33,965,525 V78L probably damaging Het
Magi3 T C 3: 104,015,765 E1212G probably benign Het
Mfap5 T C 6: 122,525,989 S75P probably damaging Het
Mn1 C A 5: 111,418,552 H129Q possibly damaging Het
Morc3 A G 16: 93,862,539 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c A G 9: 75,250,436 I224V probably damaging Het
Nupl1 T C 14: 60,223,359 T486A probably benign Het
Olfr1026 A G 2: 85,923,607 Y113C probably damaging Het
Olfr910 T A 9: 38,538,985 V30D probably damaging Het
Parp14 A T 16: 35,858,203 L465Q possibly damaging Het
Plcd3 A T 11: 103,080,400 I110N possibly damaging Het
Prx A G 7: 27,518,243 E862G probably benign Het
Rad50 G A 11: 53,707,185 probably benign Het
Rbm15 A G 3: 107,330,833 S750P probably benign Het
Reln C A 5: 22,344,369 A14S unknown Het
Rph3a T C 5: 120,954,422 Y372C probably damaging Het
Serpine2 T A 1: 79,799,539 H187L possibly damaging Het
Slc11a2 T C 15: 100,401,323 D122G probably damaging Het
Slc25a32 A T 15: 39,096,055 V289E probably damaging Het
Slc25a46 A T 18: 31,602,761 S142T probably benign Het
Srm A G 4: 148,591,504 probably null Het
Srsf5 A G 12: 80,949,096 D123G probably damaging Het
Stab1 A T 14: 31,154,872 C832S probably damaging Het
Stab2 A C 10: 86,934,840 probably benign Het
Suds3 T C 5: 117,094,953 N282S probably damaging Het
Taar9 A T 10: 24,109,254 V94E probably damaging Het
Taf2 C A 15: 55,052,247 A428S probably benign Het
Tbk1 G T 10: 121,557,259 T462K probably benign Het
Tcaf2 T G 6: 42,629,431 I530L possibly damaging Het
Tigd4 A G 3: 84,593,914 Y46C probably damaging Het
Topors G T 4: 40,261,714 Y523* probably null Het
Tpte T C 8: 22,333,160 probably benign Het
Trpv5 T A 6: 41,674,350 Q254L probably damaging Het
Trpv6 G A 6: 41,624,616 Q457* probably null Het
Ush2a A T 1: 188,267,107 M205L probably benign Het
Vmn1r90 A T 7: 14,561,718 Y152N probably damaging Het
Vmn2r124 T A 17: 18,074,018 V789D probably damaging Het
Vmn2r99 T C 17: 19,378,708 I218T probably damaging Het
Vstm2b T C 7: 40,902,875 V248A probably benign Het
Wnk2 T C 13: 49,071,029 K1019E probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp229 T A 17: 21,745,587 F266Y possibly damaging Het
Zfp616 T A 11: 74,084,268 C454* probably null Het
Other mutations in Ddx42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Ddx42 APN 11 106235749 missense probably damaging 0.98
IGL00833:Ddx42 APN 11 106231178 missense possibly damaging 0.52
IGL01095:Ddx42 APN 11 106247499 missense probably damaging 1.00
IGL01651:Ddx42 APN 11 106248029 missense probably benign 0.00
IGL01715:Ddx42 APN 11 106224275 missense probably damaging 1.00
IGL02097:Ddx42 APN 11 106239160 missense probably benign 0.00
IGL03182:Ddx42 APN 11 106247527 missense probably benign
P0045:Ddx42 UTSW 11 106231272 missense probably damaging 1.00
R0504:Ddx42 UTSW 11 106247849 missense probably benign 0.03
R0646:Ddx42 UTSW 11 106232833 missense probably benign 0.00
R2277:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2279:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2297:Ddx42 UTSW 11 106242939 missense probably damaging 1.00
R2336:Ddx42 UTSW 11 106231150 missense possibly damaging 0.56
R3413:Ddx42 UTSW 11 106247810 missense probably benign 0.00
R3498:Ddx42 UTSW 11 106231193 missense possibly damaging 0.90
R3883:Ddx42 UTSW 11 106247692 missense probably benign 0.03
R4421:Ddx42 UTSW 11 106231138 missense probably damaging 1.00
R4696:Ddx42 UTSW 11 106247703 missense probably benign 0.09
R4953:Ddx42 UTSW 11 106242940 missense probably damaging 1.00
R5398:Ddx42 UTSW 11 106224898 missense probably benign
R5669:Ddx42 UTSW 11 106241819 missense probably damaging 1.00
R6091:Ddx42 UTSW 11 106234970 missense probably damaging 1.00
R6139:Ddx42 UTSW 11 106240017 missense probably damaging 1.00
R6643:Ddx42 UTSW 11 106228820 missense probably benign 0.14
R6991:Ddx42 UTSW 11 106239144 missense probably damaging 1.00
R7351:Ddx42 UTSW 11 106247682 missense probably benign
R7502:Ddx42 UTSW 11 106247739 missense probably benign 0.00
R7792:Ddx42 UTSW 11 106236996 missense probably damaging 1.00
R8145:Ddx42 UTSW 11 106240061 missense possibly damaging 0.52
RF018:Ddx42 UTSW 11 106232804 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCACCGAAGCACACTGATAAATTTG -3'
(R):5'- CTCATGAGGCTCAGGTACAG -3'

Sequencing Primer
(F):5'- CTAATCCCAGTCCTTAGGAAGTGG -3'
(R):5'- TCATGAGGCTCAGGTACAGCAAATC -3'
Posted On2014-12-04