Incidental Mutation 'R2519:Stab1'
ID 254248
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Name stabilin 1
Synonyms MS-1
MMRRC Submission 040423-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2519 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 31139013-31168641 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31154872 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 832 (C832S)
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000036618
AA Change: C832S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: C832S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161464
Meta Mutation Damage Score 0.9596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408J17Rik G A 10: 93,589,588 probably benign Het
Actn1 A T 12: 80,192,389 H247Q probably damaging Het
Adgre1 T C 17: 57,410,956 C323R probably damaging Het
Adgrf2 T A 17: 42,710,407 I509F probably damaging Het
Aknad1 A T 3: 108,756,468 T331S probably damaging Het
Aldh1a3 T C 7: 66,422,299 D39G probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankhd1 T G 18: 36,578,543 probably null Het
Arfgef2 T C 2: 166,881,244 S1535P probably benign Het
BC027072 C T 17: 71,751,647 S345N probably damaging Het
Bicc1 T C 10: 70,930,644 E916G probably damaging Het
Birc2 A T 9: 7,821,179 D381E possibly damaging Het
Btbd11 T A 10: 85,651,611 V981D probably damaging Het
Carnmt1 A G 19: 18,693,711 I316V probably benign Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Coq7 A T 7: 118,510,148 W226R unknown Het
Cyp2d9 G A 15: 82,454,518 probably null Het
Ddx42 T A 11: 106,245,329 N635K probably damaging Het
Dmtf1 T C 5: 9,129,323 T292A possibly damaging Het
Dnajb8 T C 6: 88,222,875 V131A probably benign Het
Dock6 T C 9: 21,816,333 E1367G possibly damaging Het
Dvl1 T A 4: 155,855,543 Y377* probably null Het
Eif4g3 T A 4: 138,097,318 F278Y probably benign Het
Fancg A T 4: 43,008,787 L150H probably damaging Het
Fastkd5 T C 2: 130,616,194 T159A possibly damaging Het
Fkrp G T 7: 16,810,952 Y328* probably null Het
Fmo3 A T 1: 162,958,305 V372D probably damaging Het
Gm10639 T G 9: 78,304,439 L161R probably damaging Het
Gm12184 A G 11: 48,826,123 I76T probably damaging Het
Gm5065 A T 7: 5,359,834 I155F probably damaging Het
Gtf2h4 C A 17: 35,670,909 G143W probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn1 A T 1: 150,773,820 Y638* probably null Het
Ighv11-2 T A 12: 114,048,292 Q101L probably damaging Het
Lipf G T 19: 33,965,525 V78L probably damaging Het
Magi3 T C 3: 104,015,765 E1212G probably benign Het
Mfap5 T C 6: 122,525,989 S75P probably damaging Het
Mn1 C A 5: 111,418,552 H129Q possibly damaging Het
Morc3 A G 16: 93,862,539 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c A G 9: 75,250,436 I224V probably damaging Het
Nupl1 T C 14: 60,223,359 T486A probably benign Het
Olfr1026 A G 2: 85,923,607 Y113C probably damaging Het
Olfr910 T A 9: 38,538,985 V30D probably damaging Het
Parp14 A T 16: 35,858,203 L465Q possibly damaging Het
Plcd3 A T 11: 103,080,400 I110N possibly damaging Het
Prx A G 7: 27,518,243 E862G probably benign Het
Rad50 G A 11: 53,707,185 probably benign Het
Rbm15 A G 3: 107,330,833 S750P probably benign Het
Reln C A 5: 22,344,369 A14S unknown Het
Rph3a T C 5: 120,954,422 Y372C probably damaging Het
Serpine2 T A 1: 79,799,539 H187L possibly damaging Het
Slc11a2 T C 15: 100,401,323 D122G probably damaging Het
Slc25a32 A T 15: 39,096,055 V289E probably damaging Het
Slc25a46 A T 18: 31,602,761 S142T probably benign Het
Srm A G 4: 148,591,504 probably null Het
Srsf5 A G 12: 80,949,096 D123G probably damaging Het
Stab2 A C 10: 86,934,840 probably benign Het
Suds3 T C 5: 117,094,953 N282S probably damaging Het
Taar9 A T 10: 24,109,254 V94E probably damaging Het
Taf2 C A 15: 55,052,247 A428S probably benign Het
Tbk1 G T 10: 121,557,259 T462K probably benign Het
Tcaf2 T G 6: 42,629,431 I530L possibly damaging Het
Tigd4 A G 3: 84,593,914 Y46C probably damaging Het
Topors G T 4: 40,261,714 Y523* probably null Het
Tpte T C 8: 22,333,160 probably benign Het
Trpv5 T A 6: 41,674,350 Q254L probably damaging Het
Trpv6 G A 6: 41,624,616 Q457* probably null Het
Ush2a A T 1: 188,267,107 M205L probably benign Het
Vmn1r90 A T 7: 14,561,718 Y152N probably damaging Het
Vmn2r124 T A 17: 18,074,018 V789D probably damaging Het
Vmn2r99 T C 17: 19,378,708 I218T probably damaging Het
Vstm2b T C 7: 40,902,875 V248A probably benign Het
Wnk2 T C 13: 49,071,029 K1019E probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp229 T A 17: 21,745,587 F266Y possibly damaging Het
Zfp616 T A 11: 74,084,268 C454* probably null Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31161357 missense probably benign 0.01
IGL00323:Stab1 APN 14 31139306 missense probably benign 0.04
IGL00515:Stab1 APN 14 31159729 missense probably benign 0.20
IGL00844:Stab1 APN 14 31147066 missense probably damaging 1.00
IGL01374:Stab1 APN 14 31147075 missense probably damaging 1.00
IGL01384:Stab1 APN 14 31150408 missense probably benign
IGL01431:Stab1 APN 14 31148995 missense probably benign 0.06
IGL01787:Stab1 APN 14 31139808 missense probably damaging 1.00
IGL02128:Stab1 APN 14 31150441 missense probably damaging 1.00
IGL02138:Stab1 APN 14 31143513 critical splice donor site probably null
IGL02256:Stab1 APN 14 31141592 missense probably damaging 1.00
IGL02340:Stab1 APN 14 31140410 missense probably damaging 0.96
IGL02507:Stab1 APN 14 31139210 unclassified probably benign
IGL02695:Stab1 APN 14 31159271 missense probably damaging 1.00
IGL02755:Stab1 APN 14 31139638 missense probably benign 0.01
IGL02870:Stab1 APN 14 31139397 missense probably benign 0.00
IGL02884:Stab1 APN 14 31150143 splice site probably null
IGL03035:Stab1 APN 14 31147769 missense probably benign 0.00
IGL03267:Stab1 APN 14 31142729 missense probably damaging 1.00
IGL03286:Stab1 APN 14 31159326 splice site probably benign
IGL03366:Stab1 APN 14 31150263 missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31154407 missense probably benign 0.42
R0906_Stab1_335 UTSW 14 31145249 missense probably benign 0.19
R5086_Stab1_467 UTSW 14 31159304 missense probably damaging 1.00
IGL02835:Stab1 UTSW 14 31146024 critical splice donor site probably null
K7371:Stab1 UTSW 14 31150249 missense probably damaging 1.00
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0363:Stab1 UTSW 14 31159008 splice site probably benign
R0387:Stab1 UTSW 14 31148101 missense probably benign 0.00
R0391:Stab1 UTSW 14 31143418 missense probably benign 0.21
R0513:Stab1 UTSW 14 31148945 missense probably benign 0.08
R0546:Stab1 UTSW 14 31139550 missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31152600 missense probably benign 0.16
R0906:Stab1 UTSW 14 31145249 missense probably benign 0.19
R0963:Stab1 UTSW 14 31147274 missense probably damaging 0.97
R1219:Stab1 UTSW 14 31140621 splice site probably null
R1234:Stab1 UTSW 14 31150236 missense probably damaging 1.00
R1260:Stab1 UTSW 14 31151889 missense probably damaging 1.00
R1400:Stab1 UTSW 14 31139830 missense possibly damaging 0.92
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1440:Stab1 UTSW 14 31151690 nonsense probably null
R1472:Stab1 UTSW 14 31141586 missense probably benign 0.01
R1474:Stab1 UTSW 14 31149861 missense probably benign 0.45
R1475:Stab1 UTSW 14 31163828 missense probably benign
R1509:Stab1 UTSW 14 31151584 splice site probably benign
R1551:Stab1 UTSW 14 31160499 missense probably benign 0.00
R1572:Stab1 UTSW 14 31150823 missense probably damaging 1.00
R1633:Stab1 UTSW 14 31150380 splice site probably null
R1719:Stab1 UTSW 14 31146028 nonsense probably null
R1733:Stab1 UTSW 14 31145303 missense probably damaging 1.00
R1763:Stab1 UTSW 14 31168416 missense probably benign 0.04
R1808:Stab1 UTSW 14 31141144 missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31157465 missense probably benign 0.03
R1853:Stab1 UTSW 14 31140463 missense probably damaging 1.00
R1891:Stab1 UTSW 14 31141330 missense probably benign 0.07
R1984:Stab1 UTSW 14 31150648 missense probably benign 0.20
R1998:Stab1 UTSW 14 31162153 nonsense probably null
R2165:Stab1 UTSW 14 31168435 missense probably benign 0.20
R2191:Stab1 UTSW 14 31142800 missense probably benign 0.03
R2191:Stab1 UTSW 14 31159270 missense probably damaging 1.00
R2233:Stab1 UTSW 14 31161880 missense probably benign 0.08
R2303:Stab1 UTSW 14 31146070 missense probably damaging 1.00
R2496:Stab1 UTSW 14 31161463 missense probably damaging 1.00
R2504:Stab1 UTSW 14 31163040 critical splice donor site probably null
R2926:Stab1 UTSW 14 31161799 missense probably damaging 1.00
R4025:Stab1 UTSW 14 31154952 missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31168479 missense probably damaging 0.98
R4258:Stab1 UTSW 14 31154672 missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31157445 missense probably benign 0.01
R4644:Stab1 UTSW 14 31140487 unclassified probably benign
R4660:Stab1 UTSW 14 31154915 missense possibly damaging 0.91
R4801:Stab1 UTSW 14 31141371 nonsense probably null
R4802:Stab1 UTSW 14 31141371 nonsense probably null
R4870:Stab1 UTSW 14 31142043 missense probably benign 0.13
R4872:Stab1 UTSW 14 31140393 missense probably damaging 1.00
R4881:Stab1 UTSW 14 31143672 missense probably benign 0.32
R4941:Stab1 UTSW 14 31151571 missense probably benign 0.00
R5061:Stab1 UTSW 14 31163099 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31143624 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5087:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5092:Stab1 UTSW 14 31145855 missense probably benign 0.01
R5102:Stab1 UTSW 14 31148017 critical splice donor site probably null
R5107:Stab1 UTSW 14 31163795 splice site probably null
R5195:Stab1 UTSW 14 31140521 unclassified probably benign
R5217:Stab1 UTSW 14 31159519 missense probably benign 0.25
R5285:Stab1 UTSW 14 31143476 unclassified probably benign
R5327:Stab1 UTSW 14 31161836 nonsense probably null
R5647:Stab1 UTSW 14 31157440 nonsense probably null
R5696:Stab1 UTSW 14 31160221 missense probably benign
R5996:Stab1 UTSW 14 31139551 missense probably benign 0.39
R6016:Stab1 UTSW 14 31158993 missense probably damaging 1.00
R6017:Stab1 UTSW 14 31141544 missense probably benign 0.00
R6174:Stab1 UTSW 14 31162519 nonsense probably null
R6366:Stab1 UTSW 14 31141438 missense probably benign 0.10
R6754:Stab1 UTSW 14 31141081 missense probably benign
R6788:Stab1 UTSW 14 31139160 missense probably damaging 1.00
R6898:Stab1 UTSW 14 31158963 missense probably benign 0.00
R7124:Stab1 UTSW 14 31160867 missense possibly damaging 0.94
R7145:Stab1 UTSW 14 31145073 critical splice donor site probably null
R7153:Stab1 UTSW 14 31160584 missense probably benign 0.16
R7213:Stab1 UTSW 14 31143673 missense probably benign
R7215:Stab1 UTSW 14 31160797 missense possibly damaging 0.93
R7319:Stab1 UTSW 14 31140826 missense probably damaging 1.00
R7389:Stab1 UTSW 14 31147239 missense probably benign 0.00
R7400:Stab1 UTSW 14 31157384 missense probably null 1.00
R7427:Stab1 UTSW 14 31159259 missense probably benign 0.00
R7428:Stab1 UTSW 14 31159259 missense probably benign 0.00
R7484:Stab1 UTSW 14 31160317 missense probably benign 0.00
R7568:Stab1 UTSW 14 31152595 missense probably damaging 1.00
R7574:Stab1 UTSW 14 31154665 missense probably benign
R7619:Stab1 UTSW 14 31145237 missense probably benign
R7623:Stab1 UTSW 14 31140621 missense probably benign 0.03
R7721:Stab1 UTSW 14 31141456 missense possibly damaging 0.48
R7869:Stab1 UTSW 14 31154472 missense probably benign 0.01
R7936:Stab1 UTSW 14 31157415 missense possibly damaging 0.88
R7956:Stab1 UTSW 14 31160024 missense probably benign 0.02
R7973:Stab1 UTSW 14 31159633 critical splice donor site probably null
R8059:Stab1 UTSW 14 31160241 missense probably benign 0.02
R8116:Stab1 UTSW 14 31158953 missense possibly damaging 0.80
R8304:Stab1 UTSW 14 31148954 missense probably benign 0.14
R8368:Stab1 UTSW 14 31148411 missense possibly damaging 0.91
R8495:Stab1 UTSW 14 31155833 missense probably damaging 1.00
R8513:Stab1 UTSW 14 31149790 critical splice donor site probably null
R8544:Stab1 UTSW 14 31163051 nonsense probably null
R8671:Stab1 UTSW 14 31157408 missense probably damaging 1.00
R8885:Stab1 UTSW 14 31161814 missense possibly damaging 0.79
R8974:Stab1 UTSW 14 31160822 missense probably benign
R9022:Stab1 UTSW 14 31160269 missense probably benign 0.01
R9059:Stab1 UTSW 14 31154848 missense probably benign 0.01
R9226:Stab1 UTSW 14 31145855 missense probably benign 0.00
R9272:Stab1 UTSW 14 31145341 missense probably benign 0.05
R9388:Stab1 UTSW 14 31154355 missense probably damaging 1.00
R9401:Stab1 UTSW 14 31161112 missense probably benign
R9433:Stab1 UTSW 14 31143574 missense probably benign 0.00
R9450:Stab1 UTSW 14 31162939 missense possibly damaging 0.62
R9505:Stab1 UTSW 14 31155765 missense probably damaging 1.00
R9570:Stab1 UTSW 14 31142681 missense probably benign 0.01
R9624:Stab1 UTSW 14 31141388 missense
R9694:Stab1 UTSW 14 31154944 missense probably benign 0.06
R9723:Stab1 UTSW 14 31163891 missense probably benign 0.10
X0026:Stab1 UTSW 14 31162191 missense possibly damaging 0.91
Z1176:Stab1 UTSW 14 31142038 missense probably benign 0.00
Z1176:Stab1 UTSW 14 31150660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGCAGGAGAAGCCATTACC -3'
(R):5'- TGGTTACTATCAAGCCCCGC -3'

Sequencing Primer
(F):5'- TTACCTTCAAAACCATCATGGCAG -3'
(R):5'- ATCAAGCCCCGCTTCCTG -3'
Posted On 2014-12-04