Mutagenetix > Incidental Mutation

Incidental Mutation 'R2831:Disp1'

254271

Institutional Source

Beutler Lab

Gene Symbol

Disp1

Ensembl Gene

ENSMUSG00000030768

Gene Name

dispatched RND transporter family member 1

Synonyms

DispA, 1190008H24Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.929) question?

Stock #

R2831 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

182867830-183003086 bp(-) (GRCm39)

Type of Mutation

small deletion (2 aa in frame mutation)

DNA Base Change (assembly)

AATGGCGATGGCGATGGCG to AATGGCGATGGCG at 182870883 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]

AlphaFold

Q3TDN0

Predicted Effect

probably benign
Transcript: ENSMUST00000003035

SMART Domains

Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	279	765	6.8e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	518	670	1.7e-15	PFAM
Pfam:Patched	916	1130	8e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171366

SMART Domains

Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	272	766	2.6e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	516	671	2.2e-15	PFAM
Pfam:Patched	921	1130	8.7e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195372

SMART Domains

Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	272	766	2.6e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	516	671	2.2e-15	PFAM
Pfam:Patched	921	1130	8.7e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 12 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre5	G	A	8: 84,455,023 (GRCm39)	T225I	possibly damaging	Het
Arsg	A	G	11: 109,416,275 (GRCm39)	N174S	possibly damaging	Het
Col12a1	C	T	9: 79,604,683 (GRCm39)	V722I	probably null	Het
Col6a3	A	G	1: 90,731,435 (GRCm39)	V999A	possibly damaging	Het
Dst	A	G	1: 34,314,373 (GRCm39)	T4208A	probably damaging	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Hmcn1	A	G	1: 150,506,403 (GRCm39)		probably null	Het
Samd4b	G	C	7: 28,103,338 (GRCm39)	S40C	probably damaging	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,648 (GRCm39)		probably benign	Het
Ttc23l	G	A	15: 10,537,652 (GRCm39)	S206L	probably benign	Het
Vmn2r15	C	T	5: 109,434,458 (GRCm39)	A749T	probably damaging	Het

Other mutations in Disp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
BB006:Disp1	UTSW	1	182,917,103 (GRCm39)	missense	probably benign
BB016:Disp1	UTSW	1	182,917,103 (GRCm39)	missense	probably benign
R1120:Disp1	UTSW	1	182,880,139 (GRCm39)	missense	probably benign	0.24
R1482:Disp1	UTSW	1	182,868,038 (GRCm39)	missense	possibly damaging	0.61
R1655:Disp1	UTSW	1	182,868,568 (GRCm39)	missense	probably benign	0.01
R1660:Disp1	UTSW	1	182,869,306 (GRCm39)	missense	probably damaging	1.00
R1816:Disp1	UTSW	1	182,880,139 (GRCm39)	missense	probably damaging	0.99
R1835:Disp1	UTSW	1	182,870,564 (GRCm39)	missense	probably damaging	1.00
R1954:Disp1	UTSW	1	182,870,107 (GRCm39)	missense	probably damaging	0.99
R2025:Disp1	UTSW	1	182,869,767 (GRCm39)	missense	probably damaging	1.00
R2136:Disp1	UTSW	1	182,869,942 (GRCm39)	missense	probably damaging	1.00
R2150:Disp1	UTSW	1	182,869,936 (GRCm39)	missense	probably damaging	1.00
R2207:Disp1	UTSW	1	182,869,906 (GRCm39)	missense	possibly damaging	0.94
R2392:Disp1	UTSW	1	182,868,731 (GRCm39)	missense	probably benign
R3111:Disp1	UTSW	1	182,869,087 (GRCm39)	missense	probably damaging	1.00
R3116:Disp1	UTSW	1	182,870,486 (GRCm39)	missense	probably benign	0.01
R3160:Disp1	UTSW	1	182,868,806 (GRCm39)	missense	probably benign	0.09
R3161:Disp1	UTSW	1	182,868,806 (GRCm39)	missense	probably benign	0.09
R3162:Disp1	UTSW	1	182,868,806 (GRCm39)	missense	probably benign	0.09
R3162:Disp1	UTSW	1	182,868,806 (GRCm39)	missense	probably benign	0.09
R3716:Disp1	UTSW	1	182,869,315 (GRCm39)	missense	probably damaging	1.00
R3914:Disp1	UTSW	1	182,870,666 (GRCm39)	missense	probably benign	0.05
R4061:Disp1	UTSW	1	182,869,264 (GRCm39)	missense	probably damaging	0.96
R4191:Disp1	UTSW	1	182,870,737 (GRCm39)	missense	probably damaging	1.00
R4261:Disp1	UTSW	1	182,870,950 (GRCm39)	missense	probably damaging	1.00
R4272:Disp1	UTSW	1	182,869,208 (GRCm39)	missense	possibly damaging	0.95
R4273:Disp1	UTSW	1	182,869,208 (GRCm39)	missense	possibly damaging	0.95
R4351:Disp1	UTSW	1	182,881,542 (GRCm39)	missense	probably benign	0.01
R4672:Disp1	UTSW	1	182,880,215 (GRCm39)	critical splice acceptor site	probably null
R4764:Disp1	UTSW	1	182,869,660 (GRCm39)	missense	probably damaging	1.00
R4910:Disp1	UTSW	1	182,917,027 (GRCm39)	missense	probably damaging	1.00
R5150:Disp1	UTSW	1	182,871,063 (GRCm39)	missense	probably damaging	0.98
R5502:Disp1	UTSW	1	182,869,450 (GRCm39)	missense	probably damaging	1.00
R5616:Disp1	UTSW	1	182,869,913 (GRCm39)	missense	probably benign	0.30
R5699:Disp1	UTSW	1	182,870,119 (GRCm39)	nonsense	probably null
R5813:Disp1	UTSW	1	182,869,974 (GRCm39)	missense	probably damaging	1.00
R5820:Disp1	UTSW	1	182,917,151 (GRCm39)	missense	probably benign	0.00
R6184:Disp1	UTSW	1	182,867,896 (GRCm39)	missense	probably benign	0.00
R6228:Disp1	UTSW	1	182,880,589 (GRCm39)	missense	possibly damaging	0.59
R6306:Disp1	UTSW	1	182,868,712 (GRCm39)	missense	possibly damaging	0.93
R6505:Disp1	UTSW	1	182,868,076 (GRCm39)	missense	probably benign	0.02
R6925:Disp1	UTSW	1	182,868,042 (GRCm39)	missense	probably benign
R7016:Disp1	UTSW	1	182,869,030 (GRCm39)	missense	probably damaging	1.00
R7045:Disp1	UTSW	1	182,869,030 (GRCm39)	missense	probably damaging	1.00
R7046:Disp1	UTSW	1	182,869,030 (GRCm39)	missense	probably damaging	1.00
R7047:Disp1	UTSW	1	182,869,030 (GRCm39)	missense	probably damaging	1.00
R7114:Disp1	UTSW	1	182,869,030 (GRCm39)	missense	probably damaging	1.00
R7123:Disp1	UTSW	1	182,869,030 (GRCm39)	missense	probably damaging	1.00
R7124:Disp1	UTSW	1	182,869,030 (GRCm39)	missense	probably damaging	1.00
R7125:Disp1	UTSW	1	182,869,030 (GRCm39)	missense	probably damaging	1.00
R7161:Disp1	UTSW	1	182,869,189 (GRCm39)	missense	possibly damaging	0.84
R7510:Disp1	UTSW	1	182,869,975 (GRCm39)	missense	probably damaging	1.00
R7756:Disp1	UTSW	1	182,871,298 (GRCm39)	missense	probably damaging	1.00
R7800:Disp1	UTSW	1	182,880,550 (GRCm39)	missense	probably benign	0.00
R7929:Disp1	UTSW	1	182,917,103 (GRCm39)	missense	probably benign
R8029:Disp1	UTSW	1	182,870,852 (GRCm39)	missense	probably damaging	1.00
R8036:Disp1	UTSW	1	182,870,803 (GRCm39)	missense	probably damaging	1.00
R8045:Disp1	UTSW	1	182,870,794 (GRCm39)	missense	probably damaging	1.00
R8054:Disp1	UTSW	1	182,869,812 (GRCm39)	nonsense	probably null
R8061:Disp1	UTSW	1	182,869,151 (GRCm39)	missense	probably damaging	1.00
R8094:Disp1	UTSW	1	182,869,192 (GRCm39)	missense	probably damaging	1.00
R8130:Disp1	UTSW	1	182,917,199 (GRCm39)	missense	probably benign	0.13
R8731:Disp1	UTSW	1	182,869,072 (GRCm39)	missense	possibly damaging	0.65
R9076:Disp1	UTSW	1	182,868,799 (GRCm39)	missense	possibly damaging	0.59
R9490:Disp1	UTSW	1	182,871,092 (GRCm39)	missense	probably benign	0.03
R9712:Disp1	UTSW	1	182,917,379 (GRCm39)	missense	probably damaging	0.99
R9745:Disp1	UTSW	1	182,869,310 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACAGGACAAAAGCGTCGTC -3'
(R):5'- TACGCCGTGCCAGCTTTAAAG -3'

Sequencing Primer
(F):5'- GTCGTCCGCGCCAATCC -3'
(R):5'- GCCGTGCCAGCTTTAAAGTACAG -3'

Posted On

2014-12-04