Mutagenetix > Incidental Mutation

Incidental Mutation 'R2831:Vmn2r15'

254277

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r15

Ensembl Gene

ENSMUSG00000091375

Gene Name

vomeronasal 2, receptor 15

Synonyms

EG211223

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R2831 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109434135-109445422 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 109434458 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 749 (A749T)

Ref Sequence

ENSEMBL: ENSMUSP00000128333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167133]

AlphaFold

L7N2A0

Predicted Effect

probably damaging
Transcript: ENSMUST00000167133
AA Change: A749T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375
AA Change: A749T

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	75	472	1e-29	PFAM
Pfam:NCD3G	514	568	5.8e-18	PFAM
Pfam:7tm_3	601	836	9.1e-55	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 12 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre5	G	A	8: 84,455,023 (GRCm39)	T225I	possibly damaging	Het
Arsg	A	G	11: 109,416,275 (GRCm39)	N174S	possibly damaging	Het
Col12a1	C	T	9: 79,604,683 (GRCm39)	V722I	probably null	Het
Col6a3	A	G	1: 90,731,435 (GRCm39)	V999A	possibly damaging	Het
Disp1	AATGGCGATGGCGATGGCG	AATGGCGATGGCG	1: 182,870,883 (GRCm39)		probably benign	Het
Dst	A	G	1: 34,314,373 (GRCm39)	T4208A	probably damaging	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Hmcn1	A	G	1: 150,506,403 (GRCm39)		probably null	Het
Samd4b	G	C	7: 28,103,338 (GRCm39)	S40C	probably damaging	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,648 (GRCm39)		probably benign	Het
Ttc23l	G	A	15: 10,537,652 (GRCm39)	S206L	probably benign	Het

Other mutations in Vmn2r15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Vmn2r15	APN	5	109,434,602 (GRCm39)	missense	possibly damaging	0.70
IGL01367:Vmn2r15	APN	5	109,441,075 (GRCm39)	missense	probably damaging	0.99
IGL01844:Vmn2r15	APN	5	109,434,135 (GRCm39)	makesense	probably null
IGL02190:Vmn2r15	APN	5	109,441,240 (GRCm39)	missense	probably damaging	1.00
IGL02754:Vmn2r15	APN	5	109,441,134 (GRCm39)	nonsense	probably null
IGL02797:Vmn2r15	APN	5	109,445,250 (GRCm39)	missense	probably benign	0.18
IGL03301:Vmn2r15	APN	5	109,445,221 (GRCm39)	critical splice donor site	probably null
IGL03407:Vmn2r15	APN	5	109,434,185 (GRCm39)	nonsense	probably null
BB001:Vmn2r15	UTSW	5	109,434,254 (GRCm39)	missense	probably damaging	1.00
BB011:Vmn2r15	UTSW	5	109,434,254 (GRCm39)	missense	probably damaging	1.00
PIT4445001:Vmn2r15	UTSW	5	109,435,008 (GRCm39)	missense	probably damaging	0.99
PIT4520001:Vmn2r15	UTSW	5	109,434,871 (GRCm39)	missense	probably damaging	1.00
R0038:Vmn2r15	UTSW	5	109,441,010 (GRCm39)	missense	possibly damaging	0.46
R0111:Vmn2r15	UTSW	5	109,435,022 (GRCm39)	missense	possibly damaging	0.56
R0379:Vmn2r15	UTSW	5	109,434,344 (GRCm39)	missense	probably damaging	1.00
R0427:Vmn2r15	UTSW	5	109,434,953 (GRCm39)	missense	probably damaging	1.00
R0639:Vmn2r15	UTSW	5	109,440,881 (GRCm39)	missense	probably benign	0.22
R0964:Vmn2r15	UTSW	5	109,445,401 (GRCm39)	missense	probably benign	0.34
R1147:Vmn2r15	UTSW	5	109,441,072 (GRCm39)	missense	probably damaging	1.00
R1147:Vmn2r15	UTSW	5	109,441,072 (GRCm39)	missense	probably damaging	1.00
R1232:Vmn2r15	UTSW	5	109,441,168 (GRCm39)	missense	probably benign	0.39
R1241:Vmn2r15	UTSW	5	109,440,770 (GRCm39)	missense	probably damaging	1.00
R1244:Vmn2r15	UTSW	5	109,441,092 (GRCm39)	nonsense	probably null
R1394:Vmn2r15	UTSW	5	109,442,014 (GRCm39)	missense	probably benign	0.44
R1395:Vmn2r15	UTSW	5	109,442,014 (GRCm39)	missense	probably benign	0.44
R1423:Vmn2r15	UTSW	5	109,441,093 (GRCm39)	missense	probably damaging	1.00
R1439:Vmn2r15	UTSW	5	109,441,953 (GRCm39)	missense	probably damaging	1.00
R1513:Vmn2r15	UTSW	5	109,441,195 (GRCm39)	missense	probably damaging	1.00
R1777:Vmn2r15	UTSW	5	109,442,136 (GRCm39)	missense	possibly damaging	0.79
R1844:Vmn2r15	UTSW	5	109,434,860 (GRCm39)	nonsense	probably null
R2072:Vmn2r15	UTSW	5	109,434,619 (GRCm39)	missense	possibly damaging	0.65
R2074:Vmn2r15	UTSW	5	109,434,619 (GRCm39)	missense	possibly damaging	0.65
R2122:Vmn2r15	UTSW	5	109,434,322 (GRCm39)	missense	probably damaging	1.00
R2208:Vmn2r15	UTSW	5	109,445,309 (GRCm39)	missense	possibly damaging	0.64
R2268:Vmn2r15	UTSW	5	109,441,073 (GRCm39)	missense	probably benign	0.31
R3848:Vmn2r15	UTSW	5	109,445,312 (GRCm39)	missense	probably benign	0.00
R4058:Vmn2r15	UTSW	5	109,441,312 (GRCm39)	missense	probably damaging	0.99
R4615:Vmn2r15	UTSW	5	109,441,348 (GRCm39)	missense	possibly damaging	0.91
R4663:Vmn2r15	UTSW	5	109,441,940 (GRCm39)	missense	probably benign
R4681:Vmn2r15	UTSW	5	109,434,488 (GRCm39)	missense	probably damaging	0.97
R4751:Vmn2r15	UTSW	5	109,434,620 (GRCm39)	missense	probably benign	0.01
R5095:Vmn2r15	UTSW	5	109,436,317 (GRCm39)	critical splice acceptor site	probably null
R5300:Vmn2r15	UTSW	5	109,441,974 (GRCm39)	missense	probably damaging	0.99
R5309:Vmn2r15	UTSW	5	109,440,956 (GRCm39)	missense	probably damaging	0.99
R5335:Vmn2r15	UTSW	5	109,434,673 (GRCm39)	missense	probably damaging	0.99
R5421:Vmn2r15	UTSW	5	109,434,401 (GRCm39)	missense	probably damaging	1.00
R5805:Vmn2r15	UTSW	5	109,434,806 (GRCm39)	missense	possibly damaging	0.88
R6280:Vmn2r15	UTSW	5	109,441,291 (GRCm39)	missense	possibly damaging	0.65
R6324:Vmn2r15	UTSW	5	109,434,137 (GRCm39)	makesense	probably null
R6383:Vmn2r15	UTSW	5	109,441,092 (GRCm39)	nonsense	probably null
R6772:Vmn2r15	UTSW	5	109,434,238 (GRCm39)	missense	probably damaging	0.99
R6991:Vmn2r15	UTSW	5	109,441,180 (GRCm39)	missense	probably damaging	1.00
R7194:Vmn2r15	UTSW	5	109,440,649 (GRCm39)	missense	probably damaging	1.00
R7365:Vmn2r15	UTSW	5	109,445,388 (GRCm39)	missense	probably benign	0.15
R7365:Vmn2r15	UTSW	5	109,441,105 (GRCm39)	missense	probably benign	0.19
R7423:Vmn2r15	UTSW	5	109,445,394 (GRCm39)	missense	probably benign	0.00
R7552:Vmn2r15	UTSW	5	109,440,774 (GRCm39)	nonsense	probably null
R7619:Vmn2r15	UTSW	5	109,436,190 (GRCm39)	critical splice donor site	probably null
R7892:Vmn2r15	UTSW	5	109,434,217 (GRCm39)	missense	probably damaging	1.00
R7924:Vmn2r15	UTSW	5	109,434,254 (GRCm39)	missense	probably damaging	1.00
R8058:Vmn2r15	UTSW	5	109,440,956 (GRCm39)	missense	probably damaging	0.99
R8099:Vmn2r15	UTSW	5	109,441,185 (GRCm39)	missense	possibly damaging	0.58
R8189:Vmn2r15	UTSW	5	109,434,713 (GRCm39)	missense	probably benign	0.02
R8275:Vmn2r15	UTSW	5	109,434,150 (GRCm39)	missense	probably benign	0.08
R8277:Vmn2r15	UTSW	5	109,441,310 (GRCm39)	missense	probably damaging	1.00
R8277:Vmn2r15	UTSW	5	109,440,970 (GRCm39)	missense	probably benign	0.00
R8465:Vmn2r15	UTSW	5	109,445,302 (GRCm39)	missense	probably damaging	1.00
R8679:Vmn2r15	UTSW	5	109,434,779 (GRCm39)	missense	probably benign	0.31
R8682:Vmn2r15	UTSW	5	109,441,938 (GRCm39)	missense	probably damaging	0.98
R8809:Vmn2r15	UTSW	5	109,434,874 (GRCm39)	missense	probably benign	0.22
R9016:Vmn2r15	UTSW	5	109,442,109 (GRCm39)	missense	probably benign	0.01
R9372:Vmn2r15	UTSW	5	109,441,953 (GRCm39)	missense	possibly damaging	0.60
R9596:Vmn2r15	UTSW	5	109,440,791 (GRCm39)	missense	probably benign	0.01
R9619:Vmn2r15	UTSW	5	109,440,622 (GRCm39)	missense	possibly damaging	0.58
R9685:Vmn2r15	UTSW	5	109,440,598 (GRCm39)	missense	probably benign	0.05
R9716:Vmn2r15	UTSW	5	109,445,224 (GRCm39)	missense	possibly damaging	0.88
R9772:Vmn2r15	UTSW	5	109,434,923 (GRCm39)	missense	probably damaging	1.00
X0065:Vmn2r15	UTSW	5	109,441,174 (GRCm39)	missense	probably damaging	1.00
Z1187:Vmn2r15	UTSW	5	109,434,529 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACTAGAAGCCAAGATGG -3'
(R):5'- TCAAGCTCACTACTCCAGGG -3'

Sequencing Primer
(F):5'- ATGACCGTTCCCCTGGTG -3'
(R):5'- TCACTACTCCAGGGGGAAG -3'

Posted On

2014-12-04