Mutagenetix > Incidental Mutation

Incidental Mutation 'R2831:Adgre5'

254281

Institutional Source

Beutler Lab

Gene Symbol

Adgre5

Ensembl Gene

ENSMUSG00000002885

Gene Name

adhesion G protein-coupled receptor E5

Synonyms

EGF-TM7 receptor, Cd97

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2831 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84449874-84467812 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 84455023 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 225 (T225I)

Ref Sequence

ENSEMBL: ENSMUSP00000002964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000166939] [ENSMUST00000212949] [ENSMUST00000172396]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002964
AA Change: T225I

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885
AA Change: T225I

Domain	Start	End	E-Value	Type
EGF	30	68	1.63e1	SMART
EGF_CA	69	119	5.92e-8	SMART
EGF_CA	120	167	1.78e-11	SMART
GPS	384	430	2.18e-8	SMART
Pfam:Dicty_CAR	431	703	1.3e-8	PFAM
Pfam:7tm_2	432	672	8.1e-68	PFAM
low complexity region	704	714	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075843
AA Change: T319I

PolyPhen 2 Score 0.245 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885
AA Change: T319I

Domain	Start	End	E-Value	Type
EGF	30	68	1.63e1	SMART
EGF_CA	69	119	5.92e-8	SMART
EGF_CA	165	213	1.38e-8	SMART
EGF_CA	214	261	1.78e-11	SMART
GPS	478	524	2.18e-8	SMART
Pfam:Dicty_CAR	525	798	4.6e-8	PFAM
Pfam:7tm_2	526	766	5.3e-68	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109802
AA Change: T274I

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885
AA Change: T274I

Domain	Start	End	E-Value	Type
EGF	30	68	1.63e1	SMART
EGF_CA	69	119	5.92e-8	SMART
EGF_CA	120	168	1.38e-8	SMART
EGF_CA	169	216	1.78e-11	SMART
GPS	433	479	2.18e-8	SMART
Pfam:Dicty_CAR	480	752	5.3e-8	PFAM
Pfam:7tm_2	481	721	7.5e-67	PFAM
low complexity region	753	763	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139797

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140606

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154075

Predicted Effect

probably benign
Transcript: ENSMUST00000166939
AA Change: T223I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885
AA Change: T223I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
EGF	28	66	1.63e1	SMART
EGF_CA	67	117	5.92e-8	SMART
EGF_CA	118	165	1.78e-11	SMART
GPS	382	428	2.18e-8	SMART
Pfam:Dicty_CAR	429	701	2.1e-7	PFAM
Pfam:7tm_2	430	670	1.7e-66	PFAM
low complexity region	702	712	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184114

Predicted Effect

probably benign
Transcript: ENSMUST00000212949

Predicted Effect

probably benign
Transcript: ENSMUST00000172396

SMART Domains

Protein: ENSMUSP00000132222
Gene: ENSMUSG00000005481

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
DEXDc	63	264	4.06e-54	SMART
HELICc	300	381	9.09e-25	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EGF-TM7 subfamily of adhesion G protein-coupled receptors, which mediate cell-cell interactions. These proteins are cleaved by self-catalytic proteolysis into a large extracellular subunit and seven-span transmembrane subunit, which associate at the cell surface as a receptor complex. The encoded protein may play a role in cell adhesion as well as leukocyte recruitment, activation and migration, and contains multiple extracellular EGF-like repeats which mediate binding to chondroitin sulfate and the cell surface complement regulatory protein CD55. Expression of this gene may play a role in the progression of several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms with 3 to 5 EGF-like repeats have been observed for this gene. This gene is found in a cluster with other EGF-TM7 genes on the short arm of chromosome 19. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype apart from mild granulocytosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 12 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arsg	A	G	11: 109,416,275 (GRCm39)	N174S	possibly damaging	Het
Col12a1	C	T	9: 79,604,683 (GRCm39)	V722I	probably null	Het
Col6a3	A	G	1: 90,731,435 (GRCm39)	V999A	possibly damaging	Het
Disp1	AATGGCGATGGCGATGGCG	AATGGCGATGGCG	1: 182,870,883 (GRCm39)		probably benign	Het
Dst	A	G	1: 34,314,373 (GRCm39)	T4208A	probably damaging	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Hmcn1	A	G	1: 150,506,403 (GRCm39)		probably null	Het
Samd4b	G	C	7: 28,103,338 (GRCm39)	S40C	probably damaging	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,648 (GRCm39)		probably benign	Het
Ttc23l	G	A	15: 10,537,652 (GRCm39)	S206L	probably benign	Het
Vmn2r15	C	T	5: 109,434,458 (GRCm39)	A749T	probably damaging	Het

Other mutations in Adgre5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Adgre5	APN	8	84,455,030 (GRCm39)	missense	probably benign	0.01
IGL01365:Adgre5	APN	8	84,450,518 (GRCm39)	splice site	probably null
IGL01661:Adgre5	APN	8	84,454,564 (GRCm39)	missense	probably damaging	0.99
IGL01707:Adgre5	APN	8	84,450,976 (GRCm39)	missense	probably damaging	1.00
IGL01760:Adgre5	APN	8	84,458,586 (GRCm39)	missense	probably benign	0.02
IGL02207:Adgre5	APN	8	84,454,913 (GRCm39)	missense	probably damaging	1.00
IGL02483:Adgre5	APN	8	84,451,882 (GRCm39)	missense	probably damaging	1.00
IGL03194:Adgre5	APN	8	84,460,647 (GRCm39)	missense	possibly damaging	0.67
BB001:Adgre5	UTSW	8	84,456,029 (GRCm39)	missense	possibly damaging	0.85
BB011:Adgre5	UTSW	8	84,456,029 (GRCm39)	missense	possibly damaging	0.85
PIT4453001:Adgre5	UTSW	8	84,451,089 (GRCm39)	missense	probably benign	0.08
R0024:Adgre5	UTSW	8	84,454,913 (GRCm39)	missense	probably damaging	1.00
R0137:Adgre5	UTSW	8	84,451,527 (GRCm39)	missense	probably damaging	1.00
R0257:Adgre5	UTSW	8	84,458,624 (GRCm39)	missense	possibly damaging	0.54
R0485:Adgre5	UTSW	8	84,458,627 (GRCm39)	missense	probably damaging	0.99
R0522:Adgre5	UTSW	8	84,456,805 (GRCm39)	missense	probably benign	0.30
R0940:Adgre5	UTSW	8	84,460,126 (GRCm39)	missense	probably damaging	1.00
R1372:Adgre5	UTSW	8	84,454,949 (GRCm39)	missense	probably damaging	0.96
R1617:Adgre5	UTSW	8	84,456,806 (GRCm39)	missense	possibly damaging	0.50
R1679:Adgre5	UTSW	8	84,456,034 (GRCm39)	missense	probably benign	0.09
R1917:Adgre5	UTSW	8	84,455,738 (GRCm39)	missense	probably damaging	0.99
R1918:Adgre5	UTSW	8	84,455,738 (GRCm39)	missense	probably damaging	0.99
R2072:Adgre5	UTSW	8	84,454,433 (GRCm39)	missense	probably benign	0.24
R5250:Adgre5	UTSW	8	84,460,069 (GRCm39)	missense	probably benign
R5512:Adgre5	UTSW	8	84,455,715 (GRCm39)	missense	probably benign
R6077:Adgre5	UTSW	8	84,454,595 (GRCm39)	missense	probably benign
R7486:Adgre5	UTSW	8	84,450,515 (GRCm39)	missense	probably damaging	1.00
R7733:Adgre5	UTSW	8	84,456,025 (GRCm39)	missense	probably benign	0.06
R7924:Adgre5	UTSW	8	84,456,029 (GRCm39)	missense	possibly damaging	0.85
R8388:Adgre5	UTSW	8	84,456,815 (GRCm39)	missense	probably damaging	1.00
R9138:Adgre5	UTSW	8	84,452,563 (GRCm39)	missense	probably benign	0.29
R9625:Adgre5	UTSW	8	84,450,658 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCTCCTTCACCATCAGGG -3'
(R):5'- ACTGTGTAAGTCTTACTGCATCC -3'

Sequencing Primer
(F):5'- TTCACCATCAGGGACAGTTCTGAAG -3'
(R):5'- AAGTCTTACTGCATCCCGCCAG -3'

Posted On

2014-12-04