Incidental Mutation 'R2831:Arsg'
ID254286
Institutional Source Beutler Lab
Gene Symbol Arsg
Ensembl Gene ENSMUSG00000020604
Gene Namearylsulfatase G
Synonyms6330406P08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2831 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location109473374-109573330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109525449 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 174 (N174S)
Ref Sequence ENSEMBL: ENSMUSP00000102308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020928] [ENSMUST00000106697]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020928
AA Change: N174S

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020928
Gene: ENSMUSG00000020604
AA Change: N174S

DomainStartEndE-ValueType
Pfam:Sulfatase 36 378 2e-69 PFAM
Pfam:Sulfatase_C 401 522 2.9e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106697
AA Change: N174S

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102308
Gene: ENSMUSG00000020604
AA Change: N174S

DomainStartEndE-ValueType
Pfam:Sulfatase 36 378 2e-69 PFAM
Pfam:Sulfatase_C 401 522 4.7e-25 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfatase enzyme family. Sulfatases hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules. This protein displays arylsulfatase activity at acidic pH, as is typical of lysosomal sulfatases, and has been shown to localize in the lysosomes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a null mutation display lysosomal storage pathology in the nervous system and peripheral tissues, including the liver and kidneys, resulting in Purkinje cell loss and age dependent cognitive impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre5 G A 8: 83,728,394 T225I possibly damaging Het
Col12a1 C T 9: 79,697,401 V722I probably null Het
Col6a3 A G 1: 90,803,713 V999A possibly damaging Het
Disp1 AATGGCGATGGCGATGGCG AATGGCGATGGCG 1: 183,089,319 probably benign Het
Dst A G 1: 34,275,292 T4208A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Hmcn1 A G 1: 150,630,652 probably null Het
Samd4b G C 7: 28,403,913 S40C probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r15 C T 5: 109,286,592 A749T probably damaging Het
Other mutations in Arsg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Arsg APN 11 109525446 missense possibly damaging 0.88
IGL02257:Arsg APN 11 109521647 splice site probably benign
IGL03069:Arsg APN 11 109563256 missense probably damaging 1.00
R0421:Arsg UTSW 11 109527766 missense probably damaging 1.00
R1235:Arsg UTSW 11 109534107 critical splice donor site probably null
R1830:Arsg UTSW 11 109563274 critical splice donor site probably null
R4573:Arsg UTSW 11 109517282 missense probably damaging 1.00
R4780:Arsg UTSW 11 109534013 missense possibly damaging 0.80
R4811:Arsg UTSW 11 109534072 missense probably benign 0.00
R5510:Arsg UTSW 11 109527874 missense probably benign 0.33
R5861:Arsg UTSW 11 109563188 missense probably damaging 1.00
R5944:Arsg UTSW 11 109535311 missense probably damaging 0.99
R6502:Arsg UTSW 11 109517336 missense probably damaging 1.00
R6962:Arsg UTSW 11 109521669 missense probably damaging 1.00
X0019:Arsg UTSW 11 109563253 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCCCAGCAACGTGATTTTC -3'
(R):5'- GAAACCTACTCCCTGGATGTATTC -3'

Sequencing Primer
(F):5'- TTAATTACACACTCCGGAGTACTGC -3'
(R):5'- CTGGATGTATTCTCTATCTTTTGTGC -3'
Posted On2014-12-04