Incidental Mutation 'R2520:Sec16a'
ID254294
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene NameSEC16 homolog A, endoplasmic reticulum export factor
SynonymsC230052J16Rik
MMRRC Submission 040424-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2520 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26409431-26445216 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 26441356 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 216 (Q216*)
Ref Sequence ENSEMBL: ENSMUSP00000109716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
Predicted Effect probably null
Transcript: ENSMUST00000091252
AA Change: Q216*
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: Q216*

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114082
AA Change: Q216*
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: Q216*

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151521
Predicted Effect probably benign
Transcript: ENSMUST00000153996
SMART Domains Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
low complexity region 154 170 N/A INTRINSIC
low complexity region 205 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155252
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A T 5: 3,575,773 N70I probably damaging Het
4930503B20Rik G A 3: 146,650,506 R216W probably damaging Het
Abcb9 C T 5: 124,080,028 probably null Het
Arhgdia A T 11: 120,580,026 V72E probably damaging Het
Arsb A T 13: 93,940,699 K525* probably null Het
Bckdha A C 7: 25,641,699 I79S probably benign Het
Carm1 G A 9: 21,583,597 probably null Het
Cers5 G A 15: 99,736,381 T362I probably damaging Het
Clec4b2 T A 6: 123,200,983 F86I probably damaging Het
Crispld1 G A 1: 17,750,776 D347N probably damaging Het
Csf3r A T 4: 126,035,352 T352S probably benign Het
Daam2 G A 17: 49,480,757 Q443* probably null Het
Dcbld1 A G 10: 52,319,545 D283G probably damaging Het
Dpp9 T C 17: 56,206,868 E82G probably damaging Het
Dync1li1 A G 9: 114,689,006 D42G probably null Het
Eml6 T C 11: 29,791,993 H1130R probably damaging Het
Enox1 A T 14: 77,582,399 Y198F probably damaging Het
Epop A G 11: 97,628,728 L185P probably benign Het
Frem1 A T 4: 82,950,290 C1485S probably damaging Het
Gbf1 T A 19: 46,265,367 S571T probably benign Het
Gm5965 A T 16: 88,778,526 I196F probably null Het
Gm8237 T A 14: 5,863,642 I8L possibly damaging Het
Gria2 A C 3: 80,706,962 N590K probably damaging Het
Hectd2 T A 19: 36,612,233 probably null Het
Hmcn1 T A 1: 150,743,647 T1239S possibly damaging Het
Hps3 A T 3: 20,029,030 D167E probably damaging Het
Htr1a A G 13: 105,445,373 S374G probably benign Het
Il16 C T 7: 83,651,994 G307S probably benign Het
Ipmk T C 10: 71,381,217 F198S probably damaging Het
Lyz2 T A 10: 117,278,653 I124F probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra1 A T 7: 47,335,272 C220S possibly damaging Het
Myo5c A T 9: 75,297,649 K1595* probably null Het
Naga G T 15: 82,330,094 D405E probably benign Het
Nanog T A 6: 122,713,459 N249K probably benign Het
Nhlh1 G T 1: 172,054,003 R99S probably damaging Het
Ntrk2 T A 13: 59,054,276 probably null Het
Nudt2 A G 4: 41,480,354 E79G probably benign Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1368 A T 13: 21,142,576 C160* probably null Het
Olfr666 T A 7: 104,892,873 I252F probably benign Het
Pitpnm2 T C 5: 124,129,401 D592G probably damaging Het
Prps1l3 T C 12: 57,238,583 V53A probably damaging Het
Psmd2 T G 16: 20,663,076 V853G probably damaging Het
Pycard A G 7: 127,993,505 I50T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf168 T A 16: 32,278,403 S99T probably benign Het
Rph3al A G 11: 75,906,547 S108P possibly damaging Het
Sdk1 G A 5: 142,085,771 A979T probably benign Het
Slc35f3 T A 8: 126,394,573 V391E possibly damaging Het
Slf1 T A 13: 77,051,265 I666F probably damaging Het
Slfn14 A G 11: 83,276,187 V834A probably damaging Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tbc1d10b A G 7: 127,200,283 probably null Het
Tmeff1 T A 4: 48,604,679 C91S probably damaging Het
Tmem108 G T 9: 103,489,282 N503K possibly damaging Het
Trbv29 A G 6: 41,271,607 T24A probably damaging Het
Trim34b A G 7: 104,331,239 E178G probably damaging Het
Trmt1l T A 1: 151,453,945 H546Q probably benign Het
Ttc39d A G 17: 80,216,370 I153V probably benign Het
Ttll13 T C 7: 80,250,216 V101A probably damaging Het
Ubash3b A T 9: 41,014,947 H501Q probably damaging Het
Upf3a T A 8: 13,796,443 probably null Het
Usp48 A G 4: 137,625,251 S94G probably benign Het
Wdr86 T C 5: 24,712,575 *381W probably null Het
Wdr90 G A 17: 25,855,352 P680S probably damaging Het
Zbtb22 G A 17: 33,916,982 V34M probably damaging Het
Zbtb8a A G 4: 129,359,896 probably null Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp512b A G 2: 181,589,502 V295A probably damaging Het
Zfp608 A T 18: 54,988,506 V3E possibly damaging Het
Zfp748 G T 13: 67,546,662 D32E possibly damaging Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
PIT4486001:Sec16a UTSW 2 26425773 missense
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1959:Sec16a UTSW 2 26430132 missense probably benign 0.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2075:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3508:Sec16a UTSW 2 26425850 missense probably damaging 1.00
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4611:Sec16a UTSW 2 26441805 missense probably benign 0.04
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 unclassified probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4967:Sec16a UTSW 2 26412871 missense probably benign 0.00
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5875:Sec16a UTSW 2 26433367 missense probably damaging 1.00
R5906:Sec16a UTSW 2 26438831 missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6657:Sec16a UTSW 2 26425864 nonsense probably null
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6860:Sec16a UTSW 2 26430112 missense probably damaging 1.00
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6991:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6993:Sec16a UTSW 2 26423574 missense probably damaging 0.99
R7009:Sec16a UTSW 2 26436002 nonsense probably null
R7057:Sec16a UTSW 2 26425265 missense probably damaging 1.00
R7186:Sec16a UTSW 2 26440703 nonsense probably null
R7227:Sec16a UTSW 2 26438923 missense probably benign 0.01
R7234:Sec16a UTSW 2 26439768 missense probably damaging 1.00
R7259:Sec16a UTSW 2 26441592 missense probably benign 0.00
R7326:Sec16a UTSW 2 26439717 missense unknown
R7371:Sec16a UTSW 2 26441722 missense probably benign
R7388:Sec16a UTSW 2 26428364 missense
R7414:Sec16a UTSW 2 26423631 missense
R7417:Sec16a UTSW 2 26421397 missense
R7501:Sec16a UTSW 2 26441851 missense probably damaging 1.00
R7558:Sec16a UTSW 2 26439734 missense
R7696:Sec16a UTSW 2 26415633 critical splice donor site probably null
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Z1176:Sec16a UTSW 2 26438748 missense
Z1177:Sec16a UTSW 2 26439321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGGTGAACTATCTCATTCCC -3'
(R):5'- GTCCAGATGCTGCCACATTC -3'

Sequencing Primer
(F):5'- TTCACCACTGGCCAAGGATG -3'
(R):5'- ATTCAGCTCACTACATTCCAGGAGTG -3'
Posted On2014-12-04