Incidental Mutation 'R2842:Prkag3'
ID254295
Institutional Source Beutler Lab
Gene Symbol Prkag3
Ensembl Gene ENSMUSG00000006542
Gene Nameprotein kinase, AMP-activated, gamma 3 non-catalytic subunit
SynonymsAMPKg3L, AMPKg3, AMPKg3S
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R2842 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74738922-74749221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74741175 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 444 (I444V)
Ref Sequence ENSEMBL: ENSMUSP00000139909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027356] [ENSMUST00000081636] [ENSMUST00000113672] [ENSMUST00000160732] [ENSMUST00000162093] [ENSMUST00000188073]
Predicted Effect probably benign
Transcript: ENSMUST00000027356
SMART Domains Protein: ENSMUSP00000027356
Gene: ENSMUSG00000026170

DomainStartEndE-ValueType
Pfam:p450 63 529 5.1e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081636
AA Change: I444V

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080342
Gene: ENSMUSG00000006542
AA Change: I444V

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113672
AA Change: I419V

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109302
Gene: ENSMUSG00000006542
AA Change: I419V

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
CBS 177 226 2.66e-6 SMART
CBS 258 307 7.57e-11 SMART
CBS 333 381 8.69e-11 SMART
CBS 405 453 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160732
AA Change: I444V

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125344
Gene: ENSMUSG00000006542
AA Change: I444V

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162093
SMART Domains Protein: ENSMUSP00000125242
Gene: ENSMUSG00000006542

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188073
AA Change: I444V

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139909
Gene: ENSMUSG00000006542
AA Change: I444V

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
CBS 202 251 2.66e-6 SMART
CBS 283 332 7.57e-11 SMART
CBS 358 406 8.69e-11 SMART
CBS 430 478 3.73e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190781
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. It is dominantly expressed in skeletal muscle. Studies of the pig counterpart suggest that this subunit may play a key role in the regulation of energy metabolism in skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired glycogen synthesis after exercise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
Arl8a T C 1: 135,155,251 S181P probably damaging Het
Armc8 A G 9: 99,505,681 S396P probably benign Het
Baz2b A G 2: 59,913,004 V1541A probably benign Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Ep400 T A 5: 110,698,815 K295* probably null Het
Frem3 T A 8: 80,669,349 probably null Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gprc5b G A 7: 118,984,079 T189M possibly damaging Het
Gucy2g C T 19: 55,240,947 C97Y probably damaging Het
Heatr5a C T 12: 51,955,477 probably null Het
Heatr5a T A 12: 51,955,478 K225M probably null Het
Insr A G 8: 3,202,986 I391T probably damaging Het
Lce1e T A 3: 92,707,749 H97L unknown Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mast1 T C 8: 84,923,908 R399G probably damaging Het
Mast4 C A 13: 102,736,431 S1951I probably benign Het
Mdc1 C T 17: 35,848,794 P648S probably benign Het
Mgam T C 6: 40,661,345 F410L probably benign Het
Nr2e1 T C 10: 42,568,445 R223G probably damaging Het
Otud7b G A 3: 96,136,594 E19K probably damaging Het
Plce1 T C 19: 38,524,283 S9P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxna4 A G 6: 32,215,631 probably null Het
Rsph10b T G 5: 143,979,892 V310G possibly damaging Het
Tmem225 T C 9: 40,149,801 Y135H probably damaging Het
Tox2 G A 2: 163,204,630 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Wfikkn2 G A 11: 94,238,259 T352I probably benign Het
Other mutations in Prkag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Prkag3 APN 1 74748812 splice site probably benign
IGL02139:Prkag3 APN 1 74740724 missense probably benign 0.14
P0023:Prkag3 UTSW 1 74740739 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0002:Prkag3 UTSW 1 74744788 missense probably damaging 1.00
R0256:Prkag3 UTSW 1 74741171 missense probably benign 0.01
R0547:Prkag3 UTSW 1 74744720 critical splice donor site probably null
R1314:Prkag3 UTSW 1 74747184 missense probably damaging 1.00
R1484:Prkag3 UTSW 1 74740760 missense probably damaging 1.00
R4739:Prkag3 UTSW 1 74740705 makesense probably null
R5159:Prkag3 UTSW 1 74741487 missense probably damaging 1.00
R5876:Prkag3 UTSW 1 74748816 critical splice donor site probably benign
R5989:Prkag3 UTSW 1 74741274 missense probably benign 0.00
R7444:Prkag3 UTSW 1 74747266 missense probably benign 0.00
R7553:Prkag3 UTSW 1 74744735 missense probably damaging 1.00
R7630:Prkag3 UTSW 1 74744735 missense probably damaging 1.00
R8084:Prkag3 UTSW 1 74747207 missense probably damaging 1.00
R8115:Prkag3 UTSW 1 74747959 missense possibly damaging 0.49
Z1177:Prkag3 UTSW 1 74748025 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATTCAGCTGGCTGTGGATC -3'
(R):5'- GTATCAGAGTGCAACCTCCAGG -3'

Sequencing Primer
(F):5'- CTGTGGATCTTGGCACCAG -3'
(R):5'- AACCTCCAGGCTGCATGC -3'
Posted On2014-12-04