Incidental Mutation 'R2842:Arl8a'
List |< first << previous [record 2 of 30] next >> last >|
ID254297
Institutional Source Beutler Lab
Gene Symbol Arl8a
Ensembl Gene ENSMUSG00000026426
Gene NameADP-ribosylation factor-like 8A
Synonyms1110033P22Rik, Arl10b
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #R2842 (G1)
Quality Score160
Status Not validated
Chromosome1
Chromosomal Location135146824-135156269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135155251 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 181 (S181P)
Ref Sequence ENSEMBL: ENSMUSP00000027684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027682] [ENSMUST00000027684]
Predicted Effect probably benign
Transcript: ENSMUST00000027682
SMART Domains Protein: ENSMUSP00000027682
Gene: ENSMUSG00000026424

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:7tm_1 147 416 4.4e-25 PFAM
low complexity region 430 439 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000027684
AA Change: S181P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027684
Gene: ENSMUSG00000026426
AA Change: S181P

DomainStartEndE-ValueType
ARF 1 185 2.25e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123344
Predicted Effect unknown
Transcript: ENSMUST00000125774
AA Change: S159P
SMART Domains Protein: ENSMUSP00000121545
Gene: ENSMUSG00000026426
AA Change: S159P

DomainStartEndE-ValueType
Pfam:Roc 16 113 1e-12 PFAM
Pfam:Ras 18 162 4.2e-16 PFAM
Pfam:Arf 19 160 6.6e-41 PFAM
Pfam:Gtr1_RagA 26 155 3.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157096
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
Armc8 A G 9: 99,505,681 S396P probably benign Het
Baz2b A G 2: 59,913,004 V1541A probably benign Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Ep400 T A 5: 110,698,815 K295* probably null Het
Frem3 T A 8: 80,669,349 probably null Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gprc5b G A 7: 118,984,079 T189M possibly damaging Het
Gucy2g C T 19: 55,240,947 C97Y probably damaging Het
Heatr5a C T 12: 51,955,477 probably null Het
Heatr5a T A 12: 51,955,478 K225M probably null Het
Insr A G 8: 3,202,986 I391T probably damaging Het
Lce1e T A 3: 92,707,749 H97L unknown Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mast1 T C 8: 84,923,908 R399G probably damaging Het
Mast4 C A 13: 102,736,431 S1951I probably benign Het
Mdc1 C T 17: 35,848,794 P648S probably benign Het
Mgam T C 6: 40,661,345 F410L probably benign Het
Nr2e1 T C 10: 42,568,445 R223G probably damaging Het
Otud7b G A 3: 96,136,594 E19K probably damaging Het
Plce1 T C 19: 38,524,283 S9P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxna4 A G 6: 32,215,631 probably null Het
Prkag3 T C 1: 74,741,175 I444V probably benign Het
Rsph10b T G 5: 143,979,892 V310G possibly damaging Het
Tmem225 T C 9: 40,149,801 Y135H probably damaging Het
Tox2 G A 2: 163,204,630 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Wfikkn2 G A 11: 94,238,259 T352I probably benign Het
Other mutations in Arl8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Arl8a APN 1 135152868 critical splice donor site probably null
R0436:Arl8a UTSW 1 135146980 start codon destroyed probably null 0.45
R1639:Arl8a UTSW 1 135152823 nonsense probably null
R2393:Arl8a UTSW 1 135152866 missense probably damaging 1.00
R3873:Arl8a UTSW 1 135152872 splice site probably null
R4764:Arl8a UTSW 1 135147099 missense probably benign 0.04
R5736:Arl8a UTSW 1 135154720 missense probably benign
R6007:Arl8a UTSW 1 135152868 critical splice donor site probably null
R6989:Arl8a UTSW 1 135146997 missense probably benign
R7036:Arl8a UTSW 1 135154468 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCAGGTATTCCAGTCCCTTC -3'
(R):5'- CCTCAGCAGAATAGGGCTCTAG -3'

Sequencing Primer
(F):5'- GTCTTTTATATCACTAGCTTGGAGC -3'
(R):5'- CTCTAGGAGCCCCAGAGG -3'
Posted On2014-12-04