Incidental Mutation 'R2520:Olfr1313'
ID254298
Institutional Source Beutler Lab
Gene Symbol Olfr1313
Ensembl Gene ENSMUSG00000074946
Gene Nameolfactory receptor 1313
SynonymsGA_x6K02T2Q125-73119859-73118924, MOR245-23
MMRRC Submission 040424-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2520 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location112070088-112077843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112071668 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 305 (M305K)
Ref Sequence ENSEMBL: ENSMUSP00000148886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099599] [ENSMUST00000213577] [ENSMUST00000216071]
Predicted Effect probably benign
Transcript: ENSMUST00000099599
AA Change: M305K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097194
Gene: ENSMUSG00000074946
AA Change: M305K

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 2.2e-41 PFAM
Pfam:7tm_1 41 286 2.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213577
AA Change: M305K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000216071
AA Change: M305K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A T 5: 3,575,773 N70I probably damaging Het
4930503B20Rik G A 3: 146,650,506 R216W probably damaging Het
Abcb9 C T 5: 124,080,028 probably null Het
Arhgdia A T 11: 120,580,026 V72E probably damaging Het
Arsb A T 13: 93,940,699 K525* probably null Het
Bckdha A C 7: 25,641,699 I79S probably benign Het
Carm1 G A 9: 21,583,597 probably null Het
Cers5 G A 15: 99,736,381 T362I probably damaging Het
Clec4b2 T A 6: 123,200,983 F86I probably damaging Het
Crispld1 G A 1: 17,750,776 D347N probably damaging Het
Csf3r A T 4: 126,035,352 T352S probably benign Het
Daam2 G A 17: 49,480,757 Q443* probably null Het
Dcbld1 A G 10: 52,319,545 D283G probably damaging Het
Dpp9 T C 17: 56,206,868 E82G probably damaging Het
Dync1li1 A G 9: 114,689,006 D42G probably null Het
Eml6 T C 11: 29,791,993 H1130R probably damaging Het
Enox1 A T 14: 77,582,399 Y198F probably damaging Het
Epop A G 11: 97,628,728 L185P probably benign Het
Frem1 A T 4: 82,950,290 C1485S probably damaging Het
Gbf1 T A 19: 46,265,367 S571T probably benign Het
Gm5965 A T 16: 88,778,526 I196F probably null Het
Gm8237 T A 14: 5,863,642 I8L possibly damaging Het
Gria2 A C 3: 80,706,962 N590K probably damaging Het
Hectd2 T A 19: 36,612,233 probably null Het
Hmcn1 T A 1: 150,743,647 T1239S possibly damaging Het
Hps3 A T 3: 20,029,030 D167E probably damaging Het
Htr1a A G 13: 105,445,373 S374G probably benign Het
Il16 C T 7: 83,651,994 G307S probably benign Het
Ipmk T C 10: 71,381,217 F198S probably damaging Het
Lyz2 T A 10: 117,278,653 I124F probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra1 A T 7: 47,335,272 C220S possibly damaging Het
Myo5c A T 9: 75,297,649 K1595* probably null Het
Naga G T 15: 82,330,094 D405E probably benign Het
Nanog T A 6: 122,713,459 N249K probably benign Het
Nhlh1 G T 1: 172,054,003 R99S probably damaging Het
Ntrk2 T A 13: 59,054,276 probably null Het
Nudt2 A G 4: 41,480,354 E79G probably benign Het
Olfr1368 A T 13: 21,142,576 C160* probably null Het
Olfr666 T A 7: 104,892,873 I252F probably benign Het
Pitpnm2 T C 5: 124,129,401 D592G probably damaging Het
Prps1l3 T C 12: 57,238,583 V53A probably damaging Het
Psmd2 T G 16: 20,663,076 V853G probably damaging Het
Pycard A G 7: 127,993,505 I50T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf168 T A 16: 32,278,403 S99T probably benign Het
Rph3al A G 11: 75,906,547 S108P possibly damaging Het
Sdk1 G A 5: 142,085,771 A979T probably benign Het
Sec16a G A 2: 26,441,356 Q216* probably null Het
Slc35f3 T A 8: 126,394,573 V391E possibly damaging Het
Slf1 T A 13: 77,051,265 I666F probably damaging Het
Slfn14 A G 11: 83,276,187 V834A probably damaging Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tbc1d10b A G 7: 127,200,283 probably null Het
Tmeff1 T A 4: 48,604,679 C91S probably damaging Het
Tmem108 G T 9: 103,489,282 N503K possibly damaging Het
Trbv29 A G 6: 41,271,607 T24A probably damaging Het
Trim34b A G 7: 104,331,239 E178G probably damaging Het
Trmt1l T A 1: 151,453,945 H546Q probably benign Het
Ttc39d A G 17: 80,216,370 I153V probably benign Het
Ttll13 T C 7: 80,250,216 V101A probably damaging Het
Ubash3b A T 9: 41,014,947 H501Q probably damaging Het
Upf3a T A 8: 13,796,443 probably null Het
Usp48 A G 4: 137,625,251 S94G probably benign Het
Wdr86 T C 5: 24,712,575 *381W probably null Het
Wdr90 G A 17: 25,855,352 P680S probably damaging Het
Zbtb22 G A 17: 33,916,982 V34M probably damaging Het
Zbtb8a A G 4: 129,359,896 probably null Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp512b A G 2: 181,589,502 V295A probably damaging Het
Zfp608 A T 18: 54,988,506 V3E possibly damaging Het
Zfp748 G T 13: 67,546,662 D32E possibly damaging Het
Other mutations in Olfr1313
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Olfr1313 APN 2 112071755 missense probably damaging 0.98
IGL01790:Olfr1313 APN 2 112071921 missense probably benign 0.00
IGL02054:Olfr1313 APN 2 112071924 missense probably benign 0.43
IGL03387:Olfr1313 APN 2 112071662 missense probably benign 0.00
R1891:Olfr1313 UTSW 2 112072394 missense probably damaging 1.00
R2509:Olfr1313 UTSW 2 112072492 missense probably benign
R3084:Olfr1313 UTSW 2 112071975 nonsense probably null
R3085:Olfr1313 UTSW 2 112071975 nonsense probably null
R3086:Olfr1313 UTSW 2 112071975 nonsense probably null
R4357:Olfr1313 UTSW 2 112072238 missense probably damaging 1.00
R4700:Olfr1313 UTSW 2 112071752 missense possibly damaging 0.54
R5366:Olfr1313 UTSW 2 112072478 missense possibly damaging 0.91
R5372:Olfr1313 UTSW 2 112072109 missense probably benign 0.03
R5643:Olfr1313 UTSW 2 112071668 missense probably benign 0.00
R5644:Olfr1313 UTSW 2 112071668 missense probably benign 0.00
R5681:Olfr1313 UTSW 2 112072377 missense probably benign 0.38
R6004:Olfr1313 UTSW 2 112072026 missense probably damaging 1.00
R6609:Olfr1313 UTSW 2 112072164 missense probably benign 0.01
R7056:Olfr1313 UTSW 2 112072317 missense probably benign
R7066:Olfr1313 UTSW 2 112072196 missense probably damaging 1.00
R7417:Olfr1313 UTSW 2 112072100 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTTGGAAGAAATTGTCCCTTCC -3'
(R):5'- ACACTTTCAGCTCACGTGAC -3'

Sequencing Primer
(F):5'- GGAAGAAATTGTCCCTTCCTTATAAG -3'
(R):5'- CAGCTCACGTGACTGTAGTAG -3'
Posted On2014-12-04