Incidental Mutation 'R2520:Hps3'
ID254304
Institutional Source Beutler Lab
Gene Symbol Hps3
Ensembl Gene ENSMUSG00000027615
Gene NameHPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonymscoa, cocoa
MMRRC Submission 040424-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R2520 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location19995945-20035315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20029030 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 167 (D167E)
Ref Sequence ENSEMBL: ENSMUSP00000103957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012580] [ENSMUST00000108321]
Predicted Effect probably damaging
Transcript: ENSMUST00000012580
AA Change: D299E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012580
Gene: ENSMUSG00000027615
AA Change: D299E

DomainStartEndE-ValueType
Pfam:HPS3_N 3 212 2.8e-74 PFAM
Pfam:HPS3_Mid 255 640 1.3e-167 PFAM
Pfam:HPS3_C 649 1000 1.8e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108321
AA Change: D167E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103957
Gene: ENSMUSG00000027615
AA Change: D167E

DomainStartEndE-ValueType
Pfam:HPS3_N 3 87 5.6e-25 PFAM
Pfam:HPS3_Mid 121 508 4.2e-161 PFAM
Pfam:HPS3_C 517 870 9.2e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155121
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A T 5: 3,575,773 N70I probably damaging Het
4930503B20Rik G A 3: 146,650,506 R216W probably damaging Het
Abcb9 C T 5: 124,080,028 probably null Het
Arhgdia A T 11: 120,580,026 V72E probably damaging Het
Arsb A T 13: 93,940,699 K525* probably null Het
Bckdha A C 7: 25,641,699 I79S probably benign Het
Carm1 G A 9: 21,583,597 probably null Het
Cers5 G A 15: 99,736,381 T362I probably damaging Het
Clec4b2 T A 6: 123,200,983 F86I probably damaging Het
Crispld1 G A 1: 17,750,776 D347N probably damaging Het
Csf3r A T 4: 126,035,352 T352S probably benign Het
Daam2 G A 17: 49,480,757 Q443* probably null Het
Dcbld1 A G 10: 52,319,545 D283G probably damaging Het
Dpp9 T C 17: 56,206,868 E82G probably damaging Het
Dync1li1 A G 9: 114,689,006 D42G probably null Het
Eml6 T C 11: 29,791,993 H1130R probably damaging Het
Enox1 A T 14: 77,582,399 Y198F probably damaging Het
Epop A G 11: 97,628,728 L185P probably benign Het
Frem1 A T 4: 82,950,290 C1485S probably damaging Het
Gbf1 T A 19: 46,265,367 S571T probably benign Het
Gm5965 A T 16: 88,778,526 I196F probably null Het
Gm8237 T A 14: 5,863,642 I8L possibly damaging Het
Gria2 A C 3: 80,706,962 N590K probably damaging Het
Hectd2 T A 19: 36,612,233 probably null Het
Hmcn1 T A 1: 150,743,647 T1239S possibly damaging Het
Htr1a A G 13: 105,445,373 S374G probably benign Het
Il16 C T 7: 83,651,994 G307S probably benign Het
Ipmk T C 10: 71,381,217 F198S probably damaging Het
Lyz2 T A 10: 117,278,653 I124F probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra1 A T 7: 47,335,272 C220S possibly damaging Het
Myo5c A T 9: 75,297,649 K1595* probably null Het
Naga G T 15: 82,330,094 D405E probably benign Het
Nanog T A 6: 122,713,459 N249K probably benign Het
Nhlh1 G T 1: 172,054,003 R99S probably damaging Het
Ntrk2 T A 13: 59,054,276 probably null Het
Nudt2 A G 4: 41,480,354 E79G probably benign Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1368 A T 13: 21,142,576 C160* probably null Het
Olfr666 T A 7: 104,892,873 I252F probably benign Het
Pitpnm2 T C 5: 124,129,401 D592G probably damaging Het
Prps1l3 T C 12: 57,238,583 V53A probably damaging Het
Psmd2 T G 16: 20,663,076 V853G probably damaging Het
Pycard A G 7: 127,993,505 I50T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf168 T A 16: 32,278,403 S99T probably benign Het
Rph3al A G 11: 75,906,547 S108P possibly damaging Het
Sdk1 G A 5: 142,085,771 A979T probably benign Het
Sec16a G A 2: 26,441,356 Q216* probably null Het
Slc35f3 T A 8: 126,394,573 V391E possibly damaging Het
Slf1 T A 13: 77,051,265 I666F probably damaging Het
Slfn14 A G 11: 83,276,187 V834A probably damaging Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tbc1d10b A G 7: 127,200,283 probably null Het
Tmeff1 T A 4: 48,604,679 C91S probably damaging Het
Tmem108 G T 9: 103,489,282 N503K possibly damaging Het
Trbv29 A G 6: 41,271,607 T24A probably damaging Het
Trim34b A G 7: 104,331,239 E178G probably damaging Het
Trmt1l T A 1: 151,453,945 H546Q probably benign Het
Ttc39d A G 17: 80,216,370 I153V probably benign Het
Ttll13 T C 7: 80,250,216 V101A probably damaging Het
Ubash3b A T 9: 41,014,947 H501Q probably damaging Het
Upf3a T A 8: 13,796,443 probably null Het
Usp48 A G 4: 137,625,251 S94G probably benign Het
Wdr86 T C 5: 24,712,575 *381W probably null Het
Wdr90 G A 17: 25,855,352 P680S probably damaging Het
Zbtb22 G A 17: 33,916,982 V34M probably damaging Het
Zbtb8a A G 4: 129,359,896 probably null Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp512b A G 2: 181,589,502 V295A probably damaging Het
Zfp608 A T 18: 54,988,506 V3E possibly damaging Het
Zfp748 G T 13: 67,546,662 D32E possibly damaging Het
Other mutations in Hps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Hps3 APN 3 20019807 missense possibly damaging 0.94
IGL00846:Hps3 APN 3 20025792 missense probably benign 0.00
IGL01320:Hps3 APN 3 20030469 missense probably benign 0.12
IGL01364:Hps3 APN 3 20003305 missense possibly damaging 0.58
IGL01751:Hps3 APN 3 20010966 missense probably damaging 1.00
IGL01843:Hps3 APN 3 20029001 missense probably benign 0.05
IGL02294:Hps3 APN 3 20014048 missense probably damaging 1.00
IGL02581:Hps3 APN 3 20003221 intron probably benign
Blue UTSW 3 20030796 missense probably damaging 1.00
earl_grey UTSW 3 20017173 intron probably benign
gandalf UTSW 3 20012796 nonsense probably null
pam_gray UTSW 3 20017173 intron probably benign
R0107:Hps3 UTSW 3 20030796 missense probably damaging 1.00
R0245:Hps3 UTSW 3 20012796 nonsense probably null
R0421:Hps3 UTSW 3 20029316 missense probably benign 0.00
R0524:Hps3 UTSW 3 20012776 missense probably damaging 1.00
R0763:Hps3 UTSW 3 20003279 missense probably damaging 1.00
R1795:Hps3 UTSW 3 20012695 critical splice donor site probably null
R1864:Hps3 UTSW 3 20019959 critical splice acceptor site probably null
R2029:Hps3 UTSW 3 20030527 missense probably benign 0.01
R2101:Hps3 UTSW 3 20012783 missense possibly damaging 0.95
R2221:Hps3 UTSW 3 20002363 missense probably benign
R2268:Hps3 UTSW 3 20012935 splice site probably benign
R3809:Hps3 UTSW 3 20018812 missense probably damaging 1.00
R3888:Hps3 UTSW 3 20003223 critical splice donor site probably null
R3942:Hps3 UTSW 3 19996939 missense probably damaging 1.00
R4022:Hps3 UTSW 3 20035261 missense possibly damaging 0.69
R4156:Hps3 UTSW 3 20029229 missense probably damaging 1.00
R4739:Hps3 UTSW 3 20030410 critical splice acceptor site probably null
R4823:Hps3 UTSW 3 20012726 missense probably benign 0.03
R4912:Hps3 UTSW 3 20014173 missense probably damaging 1.00
R5307:Hps3 UTSW 3 20012701 missense possibly damaging 0.89
R5859:Hps3 UTSW 3 20008870 missense probably benign 0.02
R6140:Hps3 UTSW 3 19996987 missense probably damaging 1.00
R6183:Hps3 UTSW 3 20008868 missense probably benign 0.04
R6971:Hps3 UTSW 3 20011535 missense probably damaging 1.00
R6981:Hps3 UTSW 3 20022820 missense probably damaging 1.00
R7120:Hps3 UTSW 3 20011541 missense probably damaging 1.00
R7146:Hps3 UTSW 3 20008886 missense probably damaging 1.00
R7223:Hps3 UTSW 3 20030419 missense probably benign 0.05
R7448:Hps3 UTSW 3 20035165 missense probably damaging 0.99
R7452:Hps3 UTSW 3 20011428 missense probably damaging 1.00
R7560:Hps3 UTSW 3 20030452 missense probably benign 0.29
R7659:Hps3 UTSW 3 20022814 nonsense probably null
R7769:Hps3 UTSW 3 20018808 splice site probably null
R8050:Hps3 UTSW 3 20003328 missense probably benign
X0021:Hps3 UTSW 3 20030749 missense probably benign 0.14
X0066:Hps3 UTSW 3 20015988 missense probably damaging 1.00
Z1177:Hps3 UTSW 3 20008901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGATTGAAAAGTAGCATTCTG -3'
(R):5'- CTGGAGTCCACAGGATTAGAAG -3'

Sequencing Primer
(F):5'- CTTTCCTCAGGAAGATTCAGCAG -3'
(R):5'- TCCACAGGATTAGAAGATGAAAAAG -3'
Posted On2014-12-04