Incidental Mutation 'R2842:Lce1e'
List [record 1 of 30] next >> last >|
ID254307
Institutional Source Beutler Lab
Gene Symbol Lce1e
Ensembl Gene ENSMUSG00000068889
Gene Namelate cornified envelope 1E
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2842 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location92707401-92709074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92707749 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 97 (H97L)
Ref Sequence ENSEMBL: ENSMUSP00000088380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090867]
Predicted Effect unknown
Transcript: ENSMUST00000090867
AA Change: H97L
SMART Domains Protein: ENSMUSP00000088380
Gene: ENSMUSG00000068889
AA Change: H97L

DomainStartEndE-ValueType
Pfam:LCE 25 68 3.8e-12 PFAM
Pfam:LCE 64 129 7.3e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
Arl8a T C 1: 135,155,251 S181P probably damaging Het
Armc8 A G 9: 99,505,681 S396P probably benign Het
Baz2b A G 2: 59,913,004 V1541A probably benign Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Ep400 T A 5: 110,698,815 K295* probably null Het
Frem3 T A 8: 80,669,349 probably null Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gprc5b G A 7: 118,984,079 T189M possibly damaging Het
Gucy2g C T 19: 55,240,947 C97Y probably damaging Het
Heatr5a C T 12: 51,955,477 probably null Het
Heatr5a T A 12: 51,955,478 K225M probably null Het
Insr A G 8: 3,202,986 I391T probably damaging Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mast1 T C 8: 84,923,908 R399G probably damaging Het
Mast4 C A 13: 102,736,431 S1951I probably benign Het
Mdc1 C T 17: 35,848,794 P648S probably benign Het
Mgam T C 6: 40,661,345 F410L probably benign Het
Nr2e1 T C 10: 42,568,445 R223G probably damaging Het
Otud7b G A 3: 96,136,594 E19K probably damaging Het
Plce1 T C 19: 38,524,283 S9P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxna4 A G 6: 32,215,631 probably null Het
Prkag3 T C 1: 74,741,175 I444V probably benign Het
Rsph10b T G 5: 143,979,892 V310G possibly damaging Het
Tmem225 T C 9: 40,149,801 Y135H probably damaging Het
Tox2 G A 2: 163,204,630 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Wfikkn2 G A 11: 94,238,259 T352I probably benign Het
Other mutations in Lce1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0691:Lce1e UTSW 3 92707756 missense unknown
R1370:Lce1e UTSW 3 92707843 missense unknown
R1759:Lce1e UTSW 3 92707871 nonsense probably null
R4451:Lce1e UTSW 3 92707660 missense unknown
R4863:Lce1e UTSW 3 92707871 nonsense probably null
R4983:Lce1e UTSW 3 92707828 missense unknown
R5080:Lce1e UTSW 3 92707830 missense unknown
R6017:Lce1e UTSW 3 92707933 nonsense probably null
Z1088:Lce1e UTSW 3 92707849 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGGAACTCAGAGTGCAGG -3'
(R):5'- CAAATGTCCTCCCAAGTGCC -3'

Sequencing Primer
(F):5'- GGAGAATCTTCTGAGCATATGTTCC -3'
(R):5'- CCCCCTGTGTCTTCCTGCTG -3'
Posted On2014-12-04