Incidental Mutation 'R2842:Otud7b'
List |< first << previous [record 21 of 30] next >> last >|
ID254309
Institutional Source Beutler Lab
Gene Symbol Otud7b
Ensembl Gene ENSMUSG00000038495
Gene NameOTU domain containing 7B
Synonyms4930463P07Rik, 2900060B22Rik, Za20d1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2842 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96104527-96161129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96136594 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 19 (E19K)
Ref Sequence ENSEMBL: ENSMUSP00000115699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035519] [ENSMUST00000090785] [ENSMUST00000098849] [ENSMUST00000132980] [ENSMUST00000138206]
Predicted Effect probably damaging
Transcript: ENSMUST00000035519
AA Change: E19K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046413
Gene: ENSMUSG00000038495
AA Change: E19K

DomainStartEndE-ValueType
PDB:2L2D|A 1 59 1e-25 PDB
low complexity region 112 124 N/A INTRINSIC
Pfam:OTU 189 359 4.9e-30 PFAM
low complexity region 482 498 N/A INTRINSIC
low complexity region 527 558 N/A INTRINSIC
low complexity region 821 836 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090785
AA Change: E19K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088291
Gene: ENSMUSG00000038495
AA Change: E19K

DomainStartEndE-ValueType
PDB:2L2D|A 1 59 1e-25 PDB
low complexity region 112 124 N/A INTRINSIC
Pfam:OTU 189 359 4.9e-30 PFAM
low complexity region 482 498 N/A INTRINSIC
low complexity region 527 558 N/A INTRINSIC
low complexity region 821 836 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098849
AA Change: E19K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096449
Gene: ENSMUSG00000038495
AA Change: E19K

DomainStartEndE-ValueType
PDB:2L2D|A 1 59 1e-25 PDB
low complexity region 112 124 N/A INTRINSIC
Pfam:OTU 189 359 4.7e-27 PFAM
low complexity region 482 498 N/A INTRINSIC
low complexity region 527 558 N/A INTRINSIC
Pfam:zf-A20 797 821 6.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132980
AA Change: E19K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115699
Gene: ENSMUSG00000038495
AA Change: E19K

DomainStartEndE-ValueType
Pfam:UBA_4 6 44 8.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138206
AA Change: E19K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121847
Gene: ENSMUSG00000038495
AA Change: E19K

DomainStartEndE-ValueType
Pfam:UBA_4 6 44 2.7e-7 PFAM
low complexity region 112 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146660
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, tertiary lymphoid hyperplasia, increased stimulated B cell proliferation and survival and decreased susceptibility to C. rodentium infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
Arl8a T C 1: 135,155,251 S181P probably damaging Het
Armc8 A G 9: 99,505,681 S396P probably benign Het
Baz2b A G 2: 59,913,004 V1541A probably benign Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Ep400 T A 5: 110,698,815 K295* probably null Het
Frem3 T A 8: 80,669,349 probably null Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gprc5b G A 7: 118,984,079 T189M possibly damaging Het
Gucy2g C T 19: 55,240,947 C97Y probably damaging Het
Heatr5a C T 12: 51,955,477 probably null Het
Heatr5a T A 12: 51,955,478 K225M probably null Het
Insr A G 8: 3,202,986 I391T probably damaging Het
Lce1e T A 3: 92,707,749 H97L unknown Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mast1 T C 8: 84,923,908 R399G probably damaging Het
Mast4 C A 13: 102,736,431 S1951I probably benign Het
Mdc1 C T 17: 35,848,794 P648S probably benign Het
Mgam T C 6: 40,661,345 F410L probably benign Het
Nr2e1 T C 10: 42,568,445 R223G probably damaging Het
Plce1 T C 19: 38,524,283 S9P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxna4 A G 6: 32,215,631 probably null Het
Prkag3 T C 1: 74,741,175 I444V probably benign Het
Rsph10b T G 5: 143,979,892 V310G possibly damaging Het
Tmem225 T C 9: 40,149,801 Y135H probably damaging Het
Tox2 G A 2: 163,204,630 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Wfikkn2 G A 11: 94,238,259 T352I probably benign Het
Other mutations in Otud7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Otud7b APN 3 96150980 splice site probably benign
IGL01651:Otud7b APN 3 96153490 nonsense probably null
IGL01941:Otud7b APN 3 96155459 missense probably benign 0.00
IGL02376:Otud7b APN 3 96155037 missense possibly damaging 0.48
IGL03047:Otud7b APN 3 96150984 splice site probably benign
IGL03189:Otud7b APN 3 96155478 missense probably benign
PIT4434001:Otud7b UTSW 3 96140465 missense probably damaging 1.00
R0605:Otud7b UTSW 3 96144959 unclassified probably benign
R1364:Otud7b UTSW 3 96151451 missense probably damaging 1.00
R1570:Otud7b UTSW 3 96155891 missense probably damaging 1.00
R2172:Otud7b UTSW 3 96153520 splice site probably null
R2199:Otud7b UTSW 3 96155772 missense probably damaging 1.00
R2914:Otud7b UTSW 3 96155955 missense probably benign 0.01
R4716:Otud7b UTSW 3 96150910 missense probably damaging 0.96
R4810:Otud7b UTSW 3 96136607 missense probably damaging 1.00
R4878:Otud7b UTSW 3 96136510 utr 5 prime probably benign
R5327:Otud7b UTSW 3 96155738 missense probably benign
R5376:Otud7b UTSW 3 96153524 splice site probably null
R5530:Otud7b UTSW 3 96141488 missense probably damaging 1.00
R5741:Otud7b UTSW 3 96144304 missense probably damaging 1.00
R5877:Otud7b UTSW 3 96151960 nonsense probably null
R6365:Otud7b UTSW 3 96155250 missense probably benign 0.03
R7095:Otud7b UTSW 3 96155237 missense probably benign 0.01
R7404:Otud7b UTSW 3 96136625 critical splice donor site probably null
R7699:Otud7b UTSW 3 96155963 missense probably damaging 0.98
R7793:Otud7b UTSW 3 96155211 missense probably benign 0.01
R7840:Otud7b UTSW 3 96155373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCGGGCTGTGATGATGC -3'
(R):5'- AGTGGGCTAATCTAACTTTCCC -3'

Sequencing Primer
(F):5'- ATGCTGTTCTGGTTAGGTGAGCC -3'
(R):5'- CCTAATACATACAAGGTGACCAGGG -3'
Posted On2014-12-04