Mutagenetix > Incidental Mutations

Incidental Mutation 'R0317:Veph1'

25433

Institutional Source

Beutler Lab

Gene Symbol

Veph1

Ensembl Gene

ENSMUSG00000027831

Gene Name

ventricular zone expressed PH domain-containing 1

Synonyms

Veph, 2810471M23Rik

MMRRC Submission

038527-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0317 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66053558-66296837 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66171975 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 373 (D373G)

Ref Sequence

ENSEMBL: ENSMUSP00000029419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029419]

Predicted Effect

probably benign
Transcript: ENSMUST00000029419
AA Change: D373G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029419
Gene: ENSMUSG00000027831
AA Change: D373G

Domain	Start	End	E-Value	Type
low complexity region	59	76	N/A	INTRINSIC
Blast:PH	586	626	1e-5	BLAST
PH	717	821	1.44e-14	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,293,459	V1774A	probably damaging	Het
Adam34	G	A	8: 43,652,251	P119L	probably benign	Het
Ap3b2	T	C	7: 81,463,681		probably null	Het
Arfip2	G	A	7: 105,637,223	T124M	probably damaging	Het
Arhgef26	T	C	3: 62,423,544	S560P	probably damaging	Het
Bcl11a	A	T	11: 24,172,697		probably null	Het
Cab39	A	G	1: 85,849,160	E322G	probably damaging	Het
Cad	C	A	5: 31,072,321	P1382Q	probably benign	Het
Cc2d2a	T	C	5: 43,706,901		probably null	Het
Cela2a	A	T	4: 141,821,700		probably null	Het
Ces1e	A	C	8: 93,224,039	I38S	probably benign	Het
Ces1f	A	T	8: 93,263,391	F364I	probably benign	Het
Chgb	A	G	2: 132,793,811	T558A	probably benign	Het
Cnpy4	C	T	5: 138,192,812	Q217*	probably null	Het
Col4a3bp	C	T	13: 96,634,121	R487*	probably null	Het
Crlf1	A	G	8: 70,498,599	T43A	probably benign	Het
Dnah7b	T	A	1: 46,134,656	M707K	probably damaging	Het
Ets2	G	A	16: 95,712,149	S123N	probably damaging	Het
Fam196b	C	A	11: 34,402,826	D289E	possibly damaging	Het
Fry	T	C	5: 150,471,468	F304S	probably damaging	Het
Gadd45gip1	G	A	8: 84,834,116	R120H	probably benign	Het
Gbf1	A	G	19: 46,254,020	T96A	probably benign	Het
Ggn	T	A	7: 29,171,090	M1K	probably null	Het
Gm5239	A	G	18: 35,536,916	T112A	probably benign	Het
Kif1bp	A	T	10: 62,578,082		probably null	Het
Lrrc15	A	T	16: 30,273,743	H259Q	probably benign	Het
Lysmd4	A	G	7: 67,226,297	Y236C	probably damaging	Het
Med29	T	C	7: 28,386,859	T175A	possibly damaging	Het
Mfsd12	G	T	10: 81,357,799	D68Y	probably damaging	Het
Myh1	T	C	11: 67,217,512	L1308P	probably damaging	Het
Nphp4	T	A	4: 152,551,931		probably null	Het
Olfr948	A	G	9: 39,319,461	I51T	probably benign	Het
Pdhx	A	G	2: 103,028,280	V393A	probably benign	Het
Pgm5	A	G	19: 24,824,399	I155T	possibly damaging	Het
Pgr	A	T	9: 8,965,022	I889F	probably benign	Het
Phactr4	T	A	4: 132,386,930	K51I	probably damaging	Het
Pum2	T	A	12: 8,728,754	I468K	possibly damaging	Het
Rab11a	A	G	9: 64,725,553	S24P	probably damaging	Het
Rasef	T	C	4: 73,748,562	Q160R	probably damaging	Het
Rbl2	A	G	8: 91,087,144	D339G	probably benign	Het
Recql5	A	G	11: 115,894,673	S666P	probably benign	Het
Rfc1	A	T	5: 65,296,052		probably null	Het
Scarb1	A	G	5: 125,289,692	V59A	probably damaging	Het
Slc2a4	C	T	11: 69,946,356	V85M	probably damaging	Het
Slc6a12	A	G	6: 121,358,625	I291V	possibly damaging	Het
Slco3a1	A	C	7: 74,504,426	Y104D	probably damaging	Het
Suz12	T	A	11: 79,999,078	D13E	probably damaging	Het
Tlr1	G	T	5: 64,925,967	C422*	probably null	Het
Tmco1	T	C	1: 167,325,893	V114A	probably damaging	Het
Trpa1	T	C	1: 14,881,632	T948A	probably benign	Het
Tub	A	T	7: 109,020,927	N93Y	probably damaging	Het
Ufsp2	G	A	8: 45,992,233		probably null	Het
Vmn1r206	A	G	13: 22,620,960	S26P	possibly damaging	Het
Vmn2r1	T	C	3: 64,081,819	S60P	possibly damaging	Het
Wdcp	A	G	12: 4,851,583	S480G	probably benign	Het
Wnk4	T	C	11: 101,268,804	S612P	probably benign	Het
Zfp503	T	C	14: 21,986,459	K130E	probably benign	Het
Zkscan16	G	A	4: 58,957,602	C628Y	possibly damaging	Het

Other mutations in Veph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00755:Veph1	APN	3	66255010	missense	probably damaging	1.00
IGL01539:Veph1	APN	3	66158075	missense	probably benign	0.00
IGL01746:Veph1	APN	3	66158087	missense	probably benign
IGL02055:Veph1	APN	3	66205627	missense	possibly damaging	0.94
IGL02504:Veph1	APN	3	66172130	missense	probably damaging	1.00
IGL02610:Veph1	APN	3	66172167	missense	probably damaging	1.00
IGL02647:Veph1	APN	3	66159448	splice site	probably benign
IGL03279:Veph1	APN	3	66255022	missense	probably damaging	1.00
R0318:Veph1	UTSW	3	66057259	missense	probably damaging	1.00
R0418:Veph1	UTSW	3	66255028	nonsense	probably null
R1913:Veph1	UTSW	3	66244555	missense	probably damaging	1.00
R2081:Veph1	UTSW	3	66061102	missense	probably damaging	1.00
R2116:Veph1	UTSW	3	66057189	missense	probably benign	0.06
R3622:Veph1	UTSW	3	66215437	missense	probably benign	0.01
R3623:Veph1	UTSW	3	66215437	missense	probably benign	0.01
R3624:Veph1	UTSW	3	66215437	missense	probably benign	0.01
R3829:Veph1	UTSW	3	66159327	missense	possibly damaging	0.92
R3862:Veph1	UTSW	3	66254892	missense	probably damaging	1.00
R3974:Veph1	UTSW	3	66158227	missense	probably benign
R4209:Veph1	UTSW	3	66244546	missense	probably damaging	1.00
R4361:Veph1	UTSW	3	66159316	missense	probably benign	0.00
R4416:Veph1	UTSW	3	66061185	missense	probably damaging	0.99
R5478:Veph1	UTSW	3	66255022	missense	probably damaging	1.00
R6218:Veph1	UTSW	3	66255060	missense	probably damaging	1.00
R6399:Veph1	UTSW	3	66125891	missense	probably benign	0.03
R6655:Veph1	UTSW	3	66205613	missense	possibly damaging	0.50
R6867:Veph1	UTSW	3	66255037	missense	probably damaging	1.00
R6877:Veph1	UTSW	3	66255084	missense	probably damaging	1.00
R7257:Veph1	UTSW	3	66158282	missense	probably benign	0.00
R7723:Veph1	UTSW	3	66205672	missense	possibly damaging	0.95
X0025:Veph1	UTSW	3	66244496	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CGCTACTTGGCACTGCCATTTG -3'
(R):5'- GCCTGACATGTGATGAAGATCCCC -3'

Sequencing Primer
(F):5'- GGCACTGCCATTTGTACTTC -3'
(R):5'- CCTTCTGACTCTAAGCTGGGAATAG -3'

Posted On

2013-04-16